SubtiWiki SubtiWiki
mdtP
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mdtP
168

multidrug-efflux transporter

locus
BSU_32880
Molecular weight
57.78 kDa
pI
9.84
Protein length
Gene length
function
multidrug resistance
product
multidrug-efflux transporter
essential
no
synonyms
mdtP, yusP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
3,374,956  3,376,581
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|EmrB family] (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt),  membrane associated [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]-[gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]
description
[Pubmed|19286808]
regulatory mechanism
[protein|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]: repression, [Pubmed|19286808], in [regulon|protein:795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR regulon]
Open in new tab

[gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]→[gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]

2021-07-28 03:36:20

ghost

3

e8ef0633959f1f2e66057727f720be97f7312a4d

F311909F49C8D0FC01C8D2C80963778BC55777F7

Biological materials
Mutant
MGNA-A601 (yusP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/601 NBRP B. subtilis, Japan]
BP70 (spc) available in [wiki|Fabian Commichau]'s lab
BKE32880 ([gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGTTTGCCTTCTTTACTCA,  downstream forward: _UP4_TAATAGAGCACCCCGCGGGT
BKK32880 ([gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGTTTGCCTTCTTTACTCA,  downstream forward: _UP4_TAATAGAGCACCCCGCGGGT
References
18763711,19286808

45C61C1584A851676F15A2249F3F1092863C5AA5

Page visits: 1497

Time of last update: 2021-09-07 16:27:36

Author of last update: Melvin.boenninger