SubtiWiki SubtiWiki
ydfQ
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydfQ
168

similar to thioredoxin

locus
BSU_05510
Molecular weight
12.86 kDa
pI
7.22
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydfQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3118

This gene is a member of the following regulons

Gene
Coordinates
598,729  599,067
The protein
[wiki|Domains]
[wiki|Thioredoxin domain] (aa 1-107) (according to UniProt)
Structure
[PDB|4EUY] (from B. cereus, 34% identity)
Expression and Regulation
Operons
genes
[gene|43E088B93BBAA9FC58F4FF3CA00C0DDA82D23224|ydfQ]
description
[Pubmed|22383849]
Open in new tab

[gene|43E088B93BBAA9FC58F4FF3CA00C0DDA82D23224|ydfQ]

2021-03-21 22:37:52

Jstuelk

1

39b27501ae1b0f56f6617e2ba1e8f1cee5973d68

9952E0DCD7ED9CEDFF5DFE482843045D5CE226E3

Biological materials
Mutant
MGNA-C170 (ydfQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2168 NBRP B. subtilis, Japan]
BKE05510 ([gene|43E088B93BBAA9FC58F4FF3CA00C0DDA82D23224|ydfQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCATTTACTCCTTCAAA,  downstream forward: _UP4_TAAAGGAATAAGGCAAAAAA
BKK05510 ([gene|43E088B93BBAA9FC58F4FF3CA00C0DDA82D23224|ydfQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCATTTACTCCTTCAAA,  downstream forward: _UP4_TAAAGGAATAAGGCAAAAAA

43E088B93BBAA9FC58F4FF3CA00C0DDA82D23224

Page visits: 704

Time of last update: 2021-09-17 10:54:59

Author of last update: Melvin.boenninger