SubtiWiki SubtiWiki
zwf
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

zwf
168

glucose 6-phosphate dehydrogenase, pentose-phosphate pathway

locus
BSU_23850
Molecular weight
55.49 kDa
pI
5.28
Protein length
Gene length
function
initiation of the pentose phosphate pathway
product
glucose 6-phosphate dehydrogenase
essential
no
ec
1.1.1.49
synonyms
zwf, yqjJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0364

This gene is a member of the following regulons

Gene
Coordinates
2,479,156  2,480,625
Phenotypes of a mutant
suppresses the growth defect of [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutants on gluconeogenic substrates [Pubmed|16272399]
The protein
Catalyzed reaction/ biological activity
D-glucose 6-phosphate + NADP+ --> 6-phospho-D-glucono-1,5-lactone + H+ + NADPH (according to UniProt)
Protein family
glucose-6-phosphate dehydrogenase family (single member, according to UniProt)
[wiki|Cofactors]
Mg2+, Mn2+, Ca2+
Structure
[PDB|1DPG] (from ''Leuconostoc Mesenteroides'', 45% identity, 62% similarity) [Pubmed|7881907]
Effectors of protein activity
NAD+, NADP+ and NADPH affect the enzyme kinetic [Pubmed|6292660]
Additional information
The enzyme is a dimer [Pubmed|6292660]
Expression and Regulation
Operons
genes
[gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf]
description
[Pubmed|12850135]
regulation
constitutive [Pubmed|12850135]
Open in new tab

[gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf]

2021-09-04 10:08:46

ghost

6

f842042450fb058200856b94a2e940c000a775a4

789DF18FA105AA04511C5B1DCF8639FE110116B4

Biological materials
Mutant
MGNA-C392 (yqjJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2390 NBRP B. subtilis, Japan]
SM-NB3 (''zwf-spc''), available in [wiki|Anne Galinier]'s and [wiki|Boris Görke]'s labs [pubmed|16272399]
BKE23850 ([gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTAAAAGTACCTCACTTT,  downstream forward: _UP4_TAATAAGAAGAAAAAAGCCG
BKK23850 ([gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTAAAAGTACCTCACTTT,  downstream forward: _UP4_TAATAAGAAGAAAAAAGCCG
FLAG-tag construct
GP1401 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
References
6292660,12850135,19779711,7881907,24571712,16272399

43CD2581DA421CABC66E30389640CC86E6B2D800

Page visits: 2946

Time of last update: 2021-09-18 21:57:44

Author of last update: Melvin.boenninger