SubtiWiki SubtiWiki
yitJ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yitJ
168

bifunctional homocysteine S-methyltransferase/5,10-methylenetetrahydrofolate reductase

locus
BSU_11010
Molecular weight
67.75 kDa
pI
5.34
Protein length
Gene length
function
methionine biosynthesis, tetrahydrofolate interconversion
product
bifunctional homocysteine S-methyltransferase/5,10-methylenetetrahydrofolate reductase
essential
no
ec
2.1.1.13
synonyms
yitJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0685

This gene is a member of the following regulons

Gene
Coordinates
1,178,757  1,180,595
The protein
Catalyzed reaction/ biological activity
S-methyl-L-methionine + L-homocysteine --> 2 L-methionine (according to UniProt)
5-methyltetrahydrofolate + NAD(P)+ --> 5,10-methylenetetrahydrofolate + NAD(P)H (according to UniProt)
Protein family
C-terminal part: methylenetetrahydrofolate reductase family (single member, according to UniProt)
[wiki|Domains]
Hcy-binding domain (aa 1-280) (according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Zn2+ (according to UniProt)
Structure
[PDB|1Q7M] (the methionine synthase domain, from Thermotoga maritima, 31% identity) [pubmed|14752199]
[PDB|6FNU] (the methylene THF reductase domain, from Saccharomyces cerevisiae, 25% identity)
[wiki|Localization]
membrane associated [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|41AB43191DDB2E0698D92FFD1ECEF45100F1F3F0|yitJ]
description
[Pubmed|10094622]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
S-box: termination/antitermination, [pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
Open in new tab

[gene|41AB43191DDB2E0698D92FFD1ECEF45100F1F3F0|yitJ]

2021-10-15 02:40:00

Bzhu

4

2289c9e44d66c9a8bc58d410f5e99cfd42a78a2f

C70131650850687D9161955DFBB754F29AD58BEA

Biological materials
Mutant
MGNA-B195 (yitJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1194 NBRP B. subtilis, Japan]
BKE11010 ([gene|41AB43191DDB2E0698D92FFD1ECEF45100F1F3F0|yitJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTGCCTCCTTTATT,  downstream forward: _UP4_TAATTTCCAAAAGACTGCCT
BKK11010 ([gene|41AB43191DDB2E0698D92FFD1ECEF45100F1F3F0|yitJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTGCCTCCTTTATT,  downstream forward: _UP4_TAATTTCCAAAAGACTGCCT
References
Other publications
19779461,12107147,18763711,22960854,14752199
The [[protein|S-box]]
19258532,10094622,18039762,20951706,22543867,29604896,29794222

41AB43191DDB2E0698D92FFD1ECEF45100F1F3F0

Page visits: 1828

Time of last update: 2021-10-15 17:03:21

Author of last update: Melvin.boenninger