SubtiWiki SubtiWiki
mreBH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

mreBH
168

[wiki|cell shape]-determining protein, forms filaments, the polymers control/restrict the mobility of the cell wall elongation enzyme complex, required for [protein|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE] activity

locus
BSU_14470
Molecular weight
35.53 kDa
pI
5.24
Protein length
Gene length
function
[wiki|cell shape] determation
product
[wiki|cell shape]-determining protein
essential
no
synonyms
mreBH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1077

This gene is a member of the following regulons

Gene
Coordinates
1,516,574  1,517,581
The protein
Catalyzed reaction/ biological activity
forms ring-shaped filaments in a heterologous system [Pubmed|21091501]
required for the activity of [protein|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE] [Pubmed|23869552,16950129]
Protein family
[wiki|FtsA/MreB family] (according to UniProt)
Structure
[PDB|1JCF] ([protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB] from ''Thermotoga maritima'', 52% identity) [Pubmed|11544518]
Paralogous protein(s)
[protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl], [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB]
[wiki|Localization]
during logarithmic growth, [protein|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH] forms discrete patches thst move processively along peripheral tracks perpendicular to the cell axis [Pubmed|21636744]
forms transverse bands as cells enter the stationary phase [Pubmed|21636744]
close to the inner surface of the cytoplasmic membrane [Pubmed|16950129]
reports on helical structures formed by MreBH [Pubmed|16950129,20566861] seem to be misinterpretation of data [Pubmed|21636744]
normal localization depends on the presence of glucolipids, [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB] forms irregular clusters in an ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' mutant [Pubmed|22362028]
Expression and Regulation
Operons
genes
[gene|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH]-[gene|440E24C24D7B12175A839D7DC310339DF75BCB09|ykpC]
description
[Pubmed|27965289]
regulation
expression is increased in an [gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP] mutant [Pubmed|22362028]
induced at high temperature ([protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]) [Pubmed|24125693,18156261]
regulatory mechanism
[protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]: activation, [Pubmed|24125693], in [regulon|protein:7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR regulon]
sigma factors
[protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]: sigma factor, [Pubmed|18156261], in [regulon|protein:3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI regulon]
Open in new tab

[gene|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH]→[gene|440E24C24D7B12175A839D7DC310339DF75BCB09|ykpC]

2021-10-17 04:26:11

Bzhu

7

7cc47a93f26f6b572b81b00be5d01512884305bd

130C5D74C19DDEB65F1EE7AD141A8B90C2CCF0F3

Biological materials
Mutant
BKE14470 ([gene|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCACCCAATCTCT,  downstream forward: _UP4_TAGTCTTTACCCGCAAAATT
BKK14470 ([gene|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCACCCAATCTCT,  downstream forward: _UP4_TAGTCTTTACCCGCAAAATT
References
Other original publications
16950129,19643765,19659933,21091501,22069484,23879732,23869552,24125693,11544518,18156261,22362028,27965289,29914988
Localization
17064365,20566861,21636744,21636745,22362028,33148162

40829C3632E9DCEB9E1C14A674B4B217F504CFE0

Page visits: 2476

Time of last update: 2021-10-16 00:52:49

Author of last update: TPed