SubtiWiki SubtiWiki
sdpI
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sdpI
168

immunity protein, protection against SdpC

locus
BSU_33780
Molecular weight
23.15 kDa
pI
9.61
Protein length
Gene length
function
protection against SdpC
product
immunity protein
essential
no
ec
null
synonyms
sdpI, yvaZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5658

This gene is a member of the following regulons

Gene
Coordinates
3,466,434  3,467,057
The protein
Effectors of protein activity
in the presence of extracellular [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC], [protein|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI] binds and sequesters [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR] , this results in induction of the ''[gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]'' operon [Pubmed|16469701]
Paralogous protein(s)
[protein|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|yfhL], [protein|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]
[wiki|Localization]
membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]
description
[Pubmed|12817086]
regulation
induced by extracellular [protein|search|SdpC] ([protein|search|SdpR]) [Pubmed|16469701]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|16469701], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]: repression, [Pubmed|16469701], in [regulon|protein:29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16469701], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]→[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]

2021-06-26 16:39:42

ghost

4

5d445ea25a72afe4e546a9c2c315acdd558698ea

9D4EA374978198F0CA6504590736099562B4ED12

Biological materials
Mutant
MGNA-A454 (yvaZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/454 NBRP B. subtilis, Japan]
BKE33780 ([gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTATGGAAATTATATTTT,  downstream forward: _UP4_TGAAAAAGTGTCTTGCGGAG
BKK33780 ([gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTATGGAAATTATATTTT,  downstream forward: _UP4_TGAAAAAGTGTCTTGCGGAG
References
Reviews
20955377
Original Publications
12817086,16469701,20563570

3FB5839A7A80CF52E627FF1744E50490F5CC390F

Page visits: 1364

Time of last update: 2021-09-02 08:29:16

Author of last update: Melvin.boenninger