SubtiWiki SubtiWiki
yfmI
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfmI
168

similar to macrolide-efflux transporter

locus
BSU_07460
Molecular weight
45.45 kDa
pI
10
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfmI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
819,311  820,531
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]-[gene|B61458337D96A0CF8D0778A03A0DB68B566913D8|yfmJ]
description
[Pubmed|22383849]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]' and '[protein|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]' [PubMed|20525796]
Open in new tab

[gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]→[gene|B61458337D96A0CF8D0778A03A0DB68B566913D8|yfmJ]

2021-08-02 12:34:58

Jstuelk

4

5d36af71c362ef6a0df3e967c99377b1aee74074

1DD25548EBE0BD797FCAF6BCACDC575263155341

Biological materials
Mutant
MGNA-C242 (yfmI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2240 NBRP B. subtilis, Japan]
BKE07460 ([gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTATCCTCCCTTGGA,  downstream forward: _UP4_TAATAAATATATAAAATTTA
BKK07460 ([gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTATCCTCCCTTGGA,  downstream forward: _UP4_TAATAAATATATAAAATTTA
GP2580 ([gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]::tet comIQ12L) (in DK1042) available in [wiki|Jörg Stülke]'s lab
References
14651647,20525796,20817675

3DFC1A118B346C7939851BF711FFA31E04A698E8

Page visits: 1092

Time of last update: 2021-09-08 00:16:14

Author of last update: Melvin.boenninger