SubtiWiki SubtiWiki
sigI
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sigI
168

[wiki|RNA polymerase ][wiki|sigma factor ]SigI

locus
BSU_13450
Molecular weight
29.04 kDa
pI
8.31
Protein length
Gene length
function
control of a class of heat shock genes
product
[wiki|RNA polymerase ][wiki|sigma factor ]SigI
essential
no
synonyms
sigI, ykoZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1191

This gene is a member of the following regulons

Gene
Coordinates
1,411,892  1,412,647
Phenotypes of a mutant
temperature-sensitive growth on agar plates [Pubmed|11157964]
The protein
Protein family
[wiki|Sigma-70 factor family] (according to UniProt)
Structure
[PDB|6IVU] (from Hungateiclostridium thermocellum, corresponds to aa 141 ... 245, 38% identity) [pubmed|31106374]
[wiki|Localization]
information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000194 PRODORIC2 database]
Additional information
overexpression of SigI suppresses ''[gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB] [gene|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH] [gene|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl]'' mutants [Pubmed|19114499]
Expression and Regulation
Operons
genes
[gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]-[gene|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI]
description
[Pubmed|17185538]
regulation
induced at high temperature ([protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]) [Pubmed|23199363,17185538]
regulatory mechanism
[protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]: activation, [Pubmed|24125693,23199363], in [regulon|protein:7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR regulon]
sigma factors
[protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]: sigma factor, [Pubmed|17185538], in [regulon|protein:3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|23199363], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]→[gene|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI]

2021-09-05 16:30:00

Jstuelk

6

ff95a97a487286827832a9fb272b757c6fed831d

BE5FB124DDF0983AAB0B5C2B1ED191A5ED4E73A1

Biological materials
Mutant
MGNA-A229 (ykoZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/229 NBRP B. subtilis, Japan]
BKE13450 ([gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTCAGTTCCTCCCTATA,  downstream forward: _UP4_TATCTTAAAGGGGTGCTGCA
BKK13450 ([gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTCAGTTCCTCCCTATA,  downstream forward: _UP4_TATCTTAAAGGGGTGCTGCA
References
19114499,17185538,11157964,18156261,21541672,24125693,23199363,26744224,28333276,29914988,31106374

3DEAC421B4B173C6BBC700E57790751B7AFDF319

Page visits: 4101

Time of last update: 2021-09-15 14:04:23

Author of last update: Jstuelk