SubtiWiki SubtiWiki
sigI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

sigI
168

[wiki|RNA polymerase ][wiki|sigma factor ]SigI

locus
BSU_13450
Molecular weight
29.04 kDa
pI
8.31
Protein length
Gene length
function
control of a class of heat shock genes
product
[wiki|RNA polymerase ][wiki|sigma factor ]SigI
essential
no
synonyms
sigI, ykoZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1191

This gene is a member of the following regulons

Gene
Coordinates
1,411,892  1,412,647
Phenotypes of a mutant
temperature-sensitive growth on agar plates [Pubmed|11157964]
The protein
Protein family
[wiki|Sigma-70 factor family] (according to UniProt)
Structure
[PDB|6IVU] (from Hungateiclostridium thermocellum, corresponds to aa 141 ... 245, 38% identity) [pubmed|31106374]
[wiki|Localization]
information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000194 PRODORIC2 database]
Additional information
overexpression of SigI suppresses ''[gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB] [gene|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH] [gene|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl]'' mutants [Pubmed|19114499]
Expression and Regulation
Operons
genes
[gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]-[gene|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI]
description
[Pubmed|17185538]
regulation
induced at high temperature ([protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]) [Pubmed|23199363,17185538]
regulatory mechanism
[protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]: activation, [Pubmed|24125693,23199363], in [regulon|protein:7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR regulon]
sigma factors
[protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]: sigma factor, [Pubmed|17185538], in [regulon|protein:3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|23199363], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]→[gene|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI]

2021-11-20 22:18:10

Jstuelk

13

ff95a97a487286827832a9fb272b757c6fed831d

BE5FB124DDF0983AAB0B5C2B1ED191A5ED4E73A1

Biological materials
Mutant
MGNA-A229 (ykoZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/229 NBRP B. subtilis, Japan]
BKE13450 ([gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTCAGTTCCTCCCTATA,  downstream forward: _UP4_TATCTTAAAGGGGTGCTGCA
BKK13450 ([gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTCAGTTCCTCCCTATA,  downstream forward: _UP4_TATCTTAAAGGGGTGCTGCA
References
19114499,17185538,11157964,18156261,21541672,24125693,23199363,26744224,28333276,29914988,31106374

3DEAC421B4B173C6BBC700E57790751B7AFDF319

Page visits: 4212

Time of last update: 2021-11-27 09:22:37

Author of last update: Jstuelk