SubtiWiki SubtiWiki
yvcA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvcA
168

required for complex colony development

locus
BSU_34850
Molecular weight
27.72 kDa
pI
6.83
Protein length
Gene length
function
complex colony development
product
lipoprotein
essential
no
ec
null
synonyms
yvcA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,581,965  3,582,690
The protein
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]-[gene|56A098AF47D293AA2EC6E7E7EC2626A832BA51CD|yvcB]-[gene|F83570E87B0B3C09A17ECC60365EDF9B448C490F|yvzA]
description
[pubmed|22383849]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18978066], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|17590234], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
Open in new tab

[gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]->[gene|F83570E87B0B3C09A17ECC60365EDF9B448C490F|yvzA]

2021-07-26 19:17:28

Bzhu

1

74a17daf82b60c4ac16c4843bd37bbb9f0045c27

57C89835CA18B6FA618B6A684C2EB47ADFF0B7EC

Biological materials
Mutant
MGNA-A379 (yvcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/379 NBRP B. subtilis, Japan]
BKE34850 ([gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACGAACCTCCACGGGT,  downstream forward: _UP4_TTAATAGATAAAAAGGAGAA
BKK34850 ([gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACGAACCTCCACGGGT,  downstream forward: _UP4_TTAATAGATAAAAAGGAGAA
References
18978066,17590234

3D57D86B076CE5975C5A2516A6D26AEEFD143A55

Page visits: 1185

Time of last update: 2021-09-16 18:59:29

Author of last update: Melvin.boenninger