SubtiWiki SubtiWiki
ytaF
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytaF
168

[wiki|sporulation] protein

locus
BSU_29070
Molecular weight
17.23 kDa
pI
9.79
Protein length
Gene length
function
unknown
product
[wiki|sporulation] protein
essential
no
synonyms
ytaF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1971

This gene is a member of the following regulons

Gene
Coordinates
2,971,531  2,972,163
Phenotypes of a mutant
strongly reduced [wiki|sporulation] efficiency (10% as compared to wild type) [Pubmed|23396918]
block in stage III of [wiki|sporulation] (engulfment of the forespore) [Pubmed|23396918]
The protein
[wiki|Domains]
4 potential transmembrane domains [Pubmed|23396918]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA]-[gene|EC96EDED2472607DFA4C5EBA054157F7832EE41C|mutM]-[gene|3BEE8E248BC583FCCB37B7A209A122DD93CD398C|ytaF]-[gene|E163A282560DB882B81E783E7E95E1960F4AE4D2|ytaG]
description
[pubmed|22383849]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|23396918], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA]->[gene|E163A282560DB882B81E783E7E95E1960F4AE4D2|ytaG]

2021-09-18 16:59:49

Bzhu

9

a75923d1aa25d6709b0150853eba1995ea3a02b6

22EE8CEC7C4AE4A2CFE080A9E0FF1AE943C8B023

Biological materials
Mutant
MGNA-A117 (ytaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/117 NBRP B. subtilis, Japan]
BKE29070 ([gene|3BEE8E248BC583FCCB37B7A209A122DD93CD398C|ytaF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCGTTTCTTCCTTTC,  downstream forward: _UP4_TAAAAAGGAGTGGATCTCTT
BKK29070 ([gene|3BEE8E248BC583FCCB37B7A209A122DD93CD398C|ytaF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCGTTTCTTCCTTTC,  downstream forward: _UP4_TAAAAAGGAGTGGATCTCTT
References
23396918

3BEE8E248BC583FCCB37B7A209A122DD93CD398C

Page visits: 1117

Time of last update: 2021-09-11 18:36:30

Author of last update: Melvin.boenninger