SubtiWiki SubtiWiki
ywjC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywjC
168

general stress protein

locus
BSU_37210
Molecular weight
10.33 kDa
pI
9.32
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ywjC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,818,906  3,819,178
Expression and Regulation
Operons
genes
[gene|3AE330E2FBAB1C24FD2105472390C574DB3012CD|ywjC]
description
[Pubmed|9353933]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224,11532142]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,11532142], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|3AE330E2FBAB1C24FD2105472390C574DB3012CD|ywjC]

2021-07-27 17:41:54

ghost

1

b2c156f2d0f54bd6c3330ef3cd2d5cca1461595e

C55C049B49496BC19827538EA82FFB12AEB6FC6A

Biological materials
Mutant
BKE37210 ([gene|3AE330E2FBAB1C24FD2105472390C574DB3012CD|ywjC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTTCTCCTCCATC,  downstream forward: _UP4_TAACTTACATACAAAAAAGG
BKK37210 ([gene|3AE330E2FBAB1C24FD2105472390C574DB3012CD|ywjC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTTCTCCTCCATC,  downstream forward: _UP4_TAACTTACATACAAAAAAGG
References
11544224,9353933,11532142

3AE330E2FBAB1C24FD2105472390C574DB3012CD

Page visits: 877

Time of last update: 2021-08-02 17:35:34

Author of last update: Bzhu