SubtiWiki SubtiWiki
yqzG

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yqzG
168

unknown

locus
BSU_24650
Molecular weight
12.45 kDa
pI
9.55
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yqzG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,555,519  2,555,845
The protein
Structure
[PDB|2LYX]
Expression and Regulation
Operons
genes
[gene|3A951D23ACB109D67B77BCB42A18789EF1FC7F78|yqzG]
description
[Pubmed|22383849]
regulation
expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|3A951D23ACB109D67B77BCB42A18789EF1FC7F78|yqzG]

2021-06-18 20:12:23

ghost

1

6e6d24864e96f248097b3cf5574dafe0529a8cfc

84D4D259D5FE3AC56CE0C7B9973C5F569C5C0355

Biological materials
Mutant
MGNA-C471 (yqzG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2469 NBRP B. subtilis, Japan]
BKE24650 ([gene|3A951D23ACB109D67B77BCB42A18789EF1FC7F78|yqzG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTCACCCTTTCTTT,  downstream forward: _UP4_TAAGGTCCTCCATTTTTTGA
BKK24650 ([gene|3A951D23ACB109D67B77BCB42A18789EF1FC7F78|yqzG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTCACCCTTTCTTT,  downstream forward: _UP4_TAAGGTCCTCCATTTTTTGA
References
16497325,20817675

3A951D23ACB109D67B77BCB42A18789EF1FC7F78

Page visits: 1228

Time of last update: 2021-10-17 15:01:03

Author of last update: Melvin.boenninger