SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!



Molecular weight
12.45 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

2,555,519  2,555,845
The protein
Expression and Regulation
expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab


2021-12-01 15:50:07





Biological materials
MGNA-C471 (yqzG::erm), available at the [ NBRP B. subtilis, Japan]
BKE24650 ([gene|3A951D23ACB109D67B77BCB42A18789EF1FC7F78|yqzG]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTCACCCTTTCTTT,  downstream forward: _UP4_TAAGGTCCTCCATTTTTTGA
BKK24650 ([gene|3A951D23ACB109D67B77BCB42A18789EF1FC7F78|yqzG]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTCACCCTTTCTTT,  downstream forward: _UP4_TAAGGTCCTCCATTTTTTGA


Page visits: 1235

Time of last update: 2022-01-09 22:25:55

Author of last update: Melvin.boenninger