SubtiWiki SubtiWiki
ygzC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ygzC
168

[wiki|sporulation] protein

locus
BSU_08779
Molecular weight
11.00 kDa
pI
8.761
Protein length
Gene length
function
unknown
product
[wiki|sporulation] protein
essential
-
ec
null
synonyms
ygzC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5577

This gene is a member of the following regulons

Gene
Coordinates
954,579  954,851
Phenotypes of a mutant
the mutant forms less heat-resistant spores than the wild type strain [pubmed|32061128]
The protein
Protein family
[wiki|CotF family] (according to UniProt)
Expression and Regulation
Operons
genes
[gene|3A287357BE789CDABAD7B69BDCC09205717FF305|ygzC]
description
[Pubmed|22383849]
Open in new tab

[gene|3A287357BE789CDABAD7B69BDCC09205717FF305|ygzC]

2021-04-30 19:41:40

Jstuelk

1

afaaca63973f8e7290fb5a57a3abc523ed9a01be

C233AB869A120BF37BB2391ADFDDE09CE5CFB122

Biological materials
Mutant
BKE08779 ([gene|3A287357BE789CDABAD7B69BDCC09205717FF305|ygzC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08779 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAATGCTATAATAAGCAA,  downstream forward: _UP4_TGAGCAATTCCAAATCGATT
BKK08779 ([gene|3A287357BE789CDABAD7B69BDCC09205717FF305|ygzC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08779 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAATGCTATAATAAGCAA,  downstream forward: _UP4_TGAGCAATTCCAAATCGATT

3A287357BE789CDABAD7B69BDCC09205717FF305

Page visits: 968

Time of last update: 2021-08-05 17:53:20

Author of last update: Jstuelk