SubtiWiki SubtiWiki
spoIIAA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoIIAA
168

anti-anti-[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]

locus
BSU_23470
Molecular weight
12.85 kDa
pI
5.86
Protein length
Gene length
function
control of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF] activity
product
anti-anti-[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
essential
no
synonyms
spoIIAA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5815

This gene is a member of the following regulons

Gene
Coordinates
2,444,645  2,444,998
The protein
Protein family
anti-sigma-factor antagonist family (with [protein|AC64DA463250A090A62E50901EFE653C8F963872|rsbV], according to UniProt)
[wiki|Domains]
[wiki|STAS domain] (aa 3-113) (according to UniProt)
Structure
[PDB|1TIL] (complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB], Geobacillus stearothermophilus) [pubmed|15236958]
[PDB|1AUZ] (NMR)
Modification
phosphorylation on (Ser-58 OR Ser-59) by [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB][Pubmed|17218307], [Pubmed|16493705]
Expression and Regulation
Operons
genes
[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]-[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]-[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
description
[Pubmed|22383849]
regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|1556084,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]→[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]

2021-09-17 03:38:55

ghost

10

64b4f19f43ec57e308620c649e41be0eaadae6be

781B7F1839769E51F61804AF186C6D2AF7A0DA95

genes
[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]-[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]-[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]-[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
description
[Pubmed|22383849]
regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]→[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]

2021-09-17 03:38:56

ghost

12

3937ee398a65a809f372c4c59231b1d2e3c32629

AEBA18A2591E8C2953E0D2D62B0F6CD480E5CB2B

Biological materials
Mutant
BKE23470 ([gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCCTCCTTGAT,  downstream forward: _UP4_CTCCTGACACTGGGGGTGGC
BKK23470 ([gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCCTCCTTGAT,  downstream forward: _UP4_CTCCTGACACTGGGGGTGGC
labs
[wiki|Tony Wilkinson], York University, U.K. [http://www.york.ac.uk/depts/chem/staff/ajw.html homepage]
[wiki|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
References
Reviews
31350897,34235094
Original Publications
1391042,8358793,8955289,15023063,15351644,9077448,10323866,8820658,8622920,16824103,7570023,10476035,8932322,8764398,8764397,12676949,9826498,9826499,14744853,9642177,11684022,8846916,11298272,1948031,3114419,11846550,15201047,2123551,8168129,1556084,15687200,12850135,16493705,17218307,10049355,20817675,11846550,15236958

3936E91C062074BFE4284B54A8CC33F35F94F5EE

Page visits: 2715

Time of last update: 2021-09-17 03:52:49

Author of last update: Jstuelk