SubtiWiki SubtiWiki
alsD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

alsD
168

acetolactate decarboxylase

locus
BSU_36000
Molecular weight
28.65 kDa
pI
4.6
Protein length
Gene length
function
overflow metabolism
product
acetolactate decarboxylase
essential
no
ec
4.1.1.5
synonyms
alsD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3527

This gene is a member of the following regulons

Gene
Coordinates
3,708,799  3,709,566
Phenotypes of a mutant
reduced acetoin production [pubmed|31113899]
impaired biofilm development [pubmed|31113899]
The protein
Catalyzed reaction/ biological activity
(2S)-2-acetolactate + H+ --> (R)-acetoin + CO2 (according to UniProt)
Protein family
alpha-acetolactate decarboxylase family (single member, according to UniProt)
Structure
[PDB|5XNE] [pubmed|29796971]
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|16493705], ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC] on Ser-88 [Pubmed|20389117]
Expression and Regulation
Operons
genes
[gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]-[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]
description
[Pubmed|7685336]
regulation
induction by acetate ([protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]) [Pubmed|30039521,7685336]
expression is heterogeneous [pubmed|29809139]
regulatory mechanism
[protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]: activation, in the presence of acetate [Pubmed|7685336], in [regulon|protein:8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR regulon]
[protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]: repression, if the ratio NADH2/NAD is high [Pubmed|16428414], in [regulon|protein:B5EF521437323EF43F08E5EFDB5C798616CA499A|rex regulon]
stringent response: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript [Pubmed|20081037], in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7685336], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]→[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]

2021-11-14 00:16:20

Jstuelk

8

95ece8b3897d9d4f146bcd915028c1350cc16fc4

AFF8B3E4EA08E038C6FE3D86BD1815CA5F988C58

Biological materials
Mutant
BKE36000 ([gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCCTTCACTCCTT,  downstream forward: _UP4_TAAAAGAAAAAAAGAAAGCC
BKK36000 ([gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCCTTCACTCCTT,  downstream forward: _UP4_TAAAAGAAAAAAAGAAAGCC
Expression vectors
for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172]: pGP822, available in [wiki|Jörg Stülke]'s lab, [pubmed|20389117]
References
19087206,10986270,16428414,16493705,7685336,16428414,20081037,20389117,24734205,22178965,29809139,29796971,23985082,30039521,31113899

355E70F55A28C6C2C24E8E326EFB673AC303FBEE

Page visits: 2406

Time of last update: 2021-12-02 11:27:27

Author of last update: Melvin.boenninger