SubtiWiki SubtiWiki
alsD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

alsD
168

acetolactate decarboxylase

locus
BSU_36000
Molecular weight
28.65 kDa
pI
4.6
Protein length
Gene length
function
overflow metabolism
product
acetolactate decarboxylase
essential
no
ec
4.1.1.5
synonyms
alsD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3527

This gene is a member of the following regulons

Gene
Coordinates
3,708,799  3,709,566
Phenotypes of a mutant
reduced acetoin production [pubmed|31113899]
impaired biofilm development [pubmed|31113899]
The protein
Catalyzed reaction/ biological activity
(2S)-2-acetolactate + H+ --> (R)-acetoin + CO2 (according to UniProt)
Protein family
alpha-acetolactate decarboxylase family (single member, according to UniProt)
Structure
[PDB|5XNE] [pubmed|29796971]
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|16493705], ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC] on Ser-88 [Pubmed|20389117]
Expression and Regulation
Operons
genes
[gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]-[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]
description
[Pubmed|7685336]
regulation
induction by acetate ([protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]) [Pubmed|30039521,7685336]
expression is heterogeneous [pubmed|29809139]
regulatory mechanism
[protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]: activation, in the presence of acetate [Pubmed|7685336], in [regulon|protein:8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR regulon]
[protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]: repression, if the ratio NADH2/NAD is high [Pubmed|16428414], in [regulon|protein:B5EF521437323EF43F08E5EFDB5C798616CA499A|rex regulon]
stringent response: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript [Pubmed|20081037], in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7685336], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]→[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]

2021-09-13 17:32:54

Jstuelk

1

95ece8b3897d9d4f146bcd915028c1350cc16fc4

AFF8B3E4EA08E038C6FE3D86BD1815CA5F988C58

Biological materials
Mutant
BKE36000 ([gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCCTTCACTCCTT,  downstream forward: _UP4_TAAAAGAAAAAAAGAAAGCC
BKK36000 ([gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCCTTCACTCCTT,  downstream forward: _UP4_TAAAAGAAAAAAAGAAAGCC
Expression vectors
for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172]: pGP822, available in [wiki|Jörg Stülke]'s lab, [pubmed|20389117]
References
19087206,10986270,16428414,16493705,7685336,16428414,20081037,20389117,24734205,22178965,29809139,29796971,23985082,30039521,31113899

355E70F55A28C6C2C24E8E326EFB673AC303FBEE

Page visits: 2373

Time of last update: 2021-09-01 13:34:29

Author of last update: Melvin.boenninger