SubtiWiki SubtiWiki
yhdA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhdA
168

NADPH-dependent FMN oxidoreductase

locus
BSU_09340
Molecular weight
18.76 kDa
pI
6.51
Protein length
Gene length
function
protection against oxidative stress
product
NADPH-dependent FMN oxidoreductase
essential
no
synonyms
yhdA, azr

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0431

This gene is a member of the following regulons

Gene
Coordinates
1,010,445  1,010,969
The protein
Protein family
azoreductase type 2 family (single member, according to UniProt)
[wiki|Cofactors]
FMN [Pubmed|16752898]
NADPH [pubmed|32801174]
Structure
[PDB|3GFQ] (99% identity),
[PDB|1NNI]
Paralogous protein(s)
[protein|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM], (31%)
Expression and Regulation
Operons
genes
[gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]-[gene|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ]-[gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]
description
[Pubmed|16816187]
regulatory mechanism
[protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]: activation, [Pubmed|16816187], in [regulon|protein:49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16816187], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]→[gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]

2021-09-15 12:59:49

ghost

2

8cc56cf62393d735d27584617b4d54806f9369b1

5E51555D7512C898216E1762D43B864CFD152408

Biological materials
Mutant
MGNA-A689 (yhdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/689 NBRP B. subtilis, Japan]
BKE09340 ([gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGTGCCATTTATGACTAACA,  downstream forward: _UP4_GGCGTCTAAACGCCGGGATT
BKK09340 ([gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGTGCCATTTATGACTAACA,  downstream forward: _UP4_GGCGTCTAAACGCCGGGATT
References
16816187,16752898,20639339,20640807,32801174,33289153

345EC248C0ADF48B0C25B175241AAE982E0E9B78

Page visits: 1430

Time of last update: 2021-08-29 09:10:35

Author of last update: Robert.warneke