SubtiWiki SubtiWiki
yqzL
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqzL
168

unknown

locus
BSU_25289
Molecular weight
5.70 kDa
pI
4.127
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
yqzL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,609,750  2,609,893
Expression and Regulation
Operons
genes
[gene|0E9E9615CE056BEA2B65C494D946EB45F42A3064|cdd]-[gene|CB68B3393CA7862C45C624AF7B1ADD188243A01F|era]-[gene|33FBC31E8C24177137B0BDD8B46C1AFFD7F7B038|yqzL]-[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|6330116], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|6330116], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|0E9E9615CE056BEA2B65C494D946EB45F42A3064|cdd]→[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]

2021-09-09 06:16:42

Jstuelk

8

f5b4b68a066ead6341e5a2a464b577eb9ceaedd4

CB199ECFB0BAFE3DBDF1FFE046AD4EA2F93B5339

Biological materials
Mutant
BKE25289 ([gene|33FBC31E8C24177137B0BDD8B46C1AFFD7F7B038|yqzL]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25289 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAGAAACCCACCTTTCT,  downstream forward: _UP4_TAAACCTCTTGGCCGCTCCT
BKK25289 ([gene|33FBC31E8C24177137B0BDD8B46C1AFFD7F7B038|yqzL]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25289 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAGAAACCCACCTTTCT,  downstream forward: _UP4_TAAACCTCTTGGCCGCTCCT

33FBC31E8C24177137B0BDD8B46C1AFFD7F7B038

Page visits: 602

Time of last update: 2021-09-06 11:36:43

Author of last update: Bzhu