SubtiWiki SubtiWiki
ypjB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypjB
168

unknown

locus
BSU_22520
Molecular weight
30.43 kDa
pI
5.17
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ypjB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,361,544  2,362,338
The protein
[wiki|Localization]
membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|33C4026ABC642B03D7D857E51677F2DFAA31A144|ypjB]
description
[Pubmed|8760912]
regulation
expressed earlyduring sporulation in the mother cell ([protein|search|SigE], [wiki|SpoIIID]) [Pubmed|15699190,12662922,15383836]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|33C4026ABC642B03D7D857E51677F2DFAA31A144|ypjB]

2021-07-02 07:28:15

ghost

3

9f5cce2405ffe848011d707408f9c68e3c1cef78

5A33D28030EF91CC7E15AB830F0FD6548E4CF5E1

Biological materials
Mutant
MGNA-A405 (ypjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/405 NBRP B. subtilis, Japan]
BKE22520 ([gene|33C4026ABC642B03D7D857E51677F2DFAA31A144|ypjB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCAGGTCCCTCCCACTC,  downstream forward: _UP4_TAAGGATGAGGGGCGGCGGT
BKK22520 ([gene|33C4026ABC642B03D7D857E51677F2DFAA31A144|ypjB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCAGGTCCCTCCCACTC,  downstream forward: _UP4_TAAGGATGAGGGGCGGCGGT
References
15699190,12662922,15383836

33C4026ABC642B03D7D857E51677F2DFAA31A144

Page visits: 904

Time of last update: 2021-09-16 18:49:25

Author of last update: Melvin.boenninger