SubtiWiki SubtiWiki
ydzW/2
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydzW/2
168

putative phosphomannomutase, internal part of YdzW

locus
BSU_06074
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
ydzW/2

Genomic Context

Categories containing this gene/protein

This gene is a member of the following regulons

Gene
Coordinates
658,061  658,189
Biological materials
Mutant
BKE06074 ([gene|3201DCB2910E1442A66195868DF7574A42918F6D|ydzW/2]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06074 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGGAGAGCTTCGTATAGTG,  downstream forward: _UP4_CAGCAGACCCTCGCTGCCTT
BKK06074 ([gene|3201DCB2910E1442A66195868DF7574A42918F6D|ydzW/2]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06074 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGGAGAGCTTCGTATAGTG,  downstream forward: _UP4_CAGCAGACCCTCGCTGCCTT

3201DCB2910E1442A66195868DF7574A42918F6D

Page visits: 443

Time of last update: 2021-08-05 04:53:52

Author of last update: Bzhu