SubtiWiki SubtiWiki
acoL

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

acoL
168

acetoin dehydrogenase E3 component (dihydrolipoamide dehydrogenase)

locus
BSU_08090
Molecular weight
48.69 kDa
pI
5.27
Protein length
Gene length
function
acetoin utilization
product
acetoin dehydrogenase E3 component (dihydrolipoamide dehydrogenase)
essential
no
ec
1.8.1.4
synonyms
acoL, yfjH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1249

This gene is a member of the following regulons

Gene
Coordinates
882,266  883,642
The protein
Catalyzed reaction/ biological activity
Protein N6-(dihydrolipoyl)lysine + NAD+ --> protein N6-(lipoyl)lysine + NADH (according to UniProt)
Protein family
class-I pyridine nucleotide-disulfide oxidoreductase family (with [protein|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD] and [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV], according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|2EQ7] (from Thermus thermophilus, 40% identity)
Paralogous protein(s)
[protein|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD], [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]
[wiki|Localization]
cytoplasm (according to UniProt)
Expression and Regulation
Operons
genes
[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]
description
[pubmed|11274109]
regulation
induced by acetoin ([protein|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]) [http://www.ncbi.nlm.nih.gov/sites/entrez/11274109 PubMed]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]: activation, (interaction with [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]-containing [wiki|RNA polymerase]) [ PubMed|11274109], in [regulon|protein:706864AAF36684AD5E46F30E9EB76315AB412700|acoR regulon]
[protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]: indirect positive regulation, in [regulon|protein:7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr regulon]
sigma factors
[protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]: sigma factor, [PubMed|11274109], in [regulon|protein:1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL regulon]
additional information
the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|21815947]
Open in new tab

[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]→[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]

2021-10-16 20:32:46

Bzhu

9

13d8d82e494fdc730b04ec27f52013adc2c6a3b0

0F3039221AB7F088A4D6093D7D4525D99014DE74

additional information
the mRNA is very stable (> 15 min) [pubmed|12884008]
Biological materials
Mutant
MGNA-C351 (acoL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2349 NBRP B. subtilis, Japan]
BKE08090 ([gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTTTTCACCTGCTT,  downstream forward: _UP4_TAATAAAGGAAAAAGCAGGC
BKK08090 ([gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTTTTCACCTGCTT,  downstream forward: _UP4_TAATAAAGGAAAAAGCAGGC
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
References
11274109,10368162,10666464,16428414,12884008,21815947

2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632

Page visits: 2034

Time of last update: 2021-10-21 01:26:10

Author of last update: LKrueger