SubtiWiki SubtiWiki
gerPC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gerPC
168

spore germination protein, facilitates access of nutrient germinants to their cognate germinant receptors in spores inner membrane

locus
BSU_10700
Molecular weight
24.09 kDa
pI
4.76
Protein length
Gene length
function
germination
product
unknown
essential
no
ec
null
synonyms
gerPC, yisF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5908

This gene is a member of the following regulons

Gene
Coordinates
1,149,318  1,149,935
Expression and Regulation
Operons
genes
[gene|C4DA51243A4249B2489133C8EF0F8A30B05F4C86|gerPA]-[gene|B52A09BF195FE8E143FCB2EF5EBA53454A4ED3D5|gerPB]-[gene|2C49C261D2C7EEDD8E01A384917B63B6965B4AB9|gerPC]-[gene|F8658BB6D52793F8EC289FEC652241D729D72BF6|gerPD]-[gene|53833A2E7176C04AF2E3F7CD7FC9928DC1A0110D|gerPE]-[gene|C2DDBBD801BC61B89024198624360CC55D208247|gerPF]
description
[Pubmed|22383849]
regulation
expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10715007]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: repression, in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|search|gerPA]' and '[protein|search|yisI]' [PubMed|20525796]
Open in new tab

[gene|C4DA51243A4249B2489133C8EF0F8A30B05F4C86|gerPA]→[gene|C2DDBBD801BC61B89024198624360CC55D208247|gerPF]

2021-07-14 11:16:03

ghost

6

6fa2f0d08b48cd40ad0896e4e5b04f2b2cdd8e4a

C61A0A588140608A780E8D2989E7166E56693D05

Biological materials
Mutant
MGNA-B188 (yisF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1187 NBRP B. subtilis, Japan]
BKE10700 ([gene|2C49C261D2C7EEDD8E01A384917B63B6965B4AB9|gerPC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTCACCTCTTTCA,  downstream forward: _UP4_GAAATGAAAGGAGATGAGCA
BKK10700 ([gene|2C49C261D2C7EEDD8E01A384917B63B6965B4AB9|gerPC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTCACCTCTTTCA,  downstream forward: _UP4_GAAATGAAAGGAGATGAGCA
References
10715007

2C49C261D2C7EEDD8E01A384917B63B6965B4AB9

Page visits: 832

Time of last update: 2021-08-31 14:05:03

Author of last update: Bzhu