SubtiWiki SubtiWiki
yoyE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yoyE
168

unknown

locus
BSU_19639
Molecular weight
4.70 kDa
pI
10.09
Protein length
Gene length
function
unknown
product
unknown
essential
-
synonyms
yoyE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,136,373  2,136,498
Expression and Regulation
Operons
genes
[gene|2C216134CB23B7102542C43D25CBEE206145E026|yoyE]
description
[pubmed|22383849]
regulation
expressed during sporulation ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]) [pubmed|22383849]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [pubmed|30782632], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|2C216134CB23B7102542C43D25CBEE206145E026|yoyE]

2021-04-30 09:09:09

Jstuelk

1

5e4f88b39fe2b142365c8e9f73072b6cf730b64f

D2218A7C6789E9CD64D619AB31AA13FA21CDBA91

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE19639 ([gene|2C216134CB23B7102542C43D25CBEE206145E026|yoyE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19639 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCCACCCCTCCTTCC,  downstream forward: _UP4_TAAAACTGCAGAAAACTGCG
BKK19639 ([gene|2C216134CB23B7102542C43D25CBEE206145E026|yoyE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19639 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCCACCCCTCCTTCC,  downstream forward: _UP4_TAAAACTGCAGAAAACTGCG
References
Research papers
30782632

2C216134CB23B7102542C43D25CBEE206145E026

Page visits: 788

Time of last update: 2021-09-16 01:19:52

Author of last update: Jstuelk