SubtiWiki SubtiWiki
disA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

disA
168

DNA integrity scanning protein, diadenylate cyclase, delays [wiki|sporulation] in the case of chromosome damage, the DisA-dependent checkpoint arrests [wiki|DNA replication] during B. subtilis spore outgrowth until the germinating spores genome is free of damage

locus
BSU_00880
Molecular weight
40.58 kDa
pI
5.57
Protein length
Gene length
function
control of [wiki|sporulation] initiation
product
DNA integrity scanning protein, has diadenylate cyclase activity
essential
no
ec
2.7.7.85
synonyms
disA, yacK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1623

This gene is a member of the following regulons

Gene
Coordinates
107,476  108,558
Phenotypes of a mutant
a [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] double mutant or [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
reduced spore survival after infrared exposure [pubmed|28961460]
altered morphology on MSgg medium [pubmed|29588402]
plant root colonization defect [pubmed|29588402]
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352,21566650]
binds [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] to inhibit its activity [pubmed|30916351]
limits [protein|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] activities at stalled or reversed replication forks [pubmed|34073022]
Protein family
DisA family (single member, according to UniProt)
[wiki|Domains]
contains a [wiki|DAC domain] for the synthesis of c-di-AMP [Pubmed|18439896]
[wiki|DAC domain] (aa 11-149) (according to UniProt)
[wiki|Cofactors]
Mn2+ [pubmed|26014055]
Structure
[PDB|3C23] [Pubmed|18439896]
Effectors of protein activity
[protein|151F226370D225776F3FE7EA4901485095F1AC45|radA] is an inhibitor of [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] activity [Pubmed|23760274]
the presence of potassium results in enhanced activity [pubmed|28420751]
[wiki|Localization]
see a [http://download.cell.com/mmcs/journals/0092-8674/PIIS0092867406005034.mmc12.avi video] showing the movement of DisA in the cell (in real time) [Pubmed|16713562]
forms discrete globular foci in germinating spres that colocalize with the nucleoid [Pubmed|24244006]
forms rapidly moving focus that pauses at [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]-mediated recombination intermediates upon induction of DNA damage during spore development [pubmed|30916351]
Expression and Regulation
Operons
genes
[gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]-[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]-[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
description
[Pubmed|8793870]
regulation
expressed during germination and spore outgrowth [Pubmed|24244006]
regulatory mechanism
[protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|protein:908DB17A39D518E84977250C55825E77FA02E391|ctsR regulon]
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [pubmed|30962353], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|17434969], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8793870], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]→[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]

2021-09-17 22:56:44

Bzhu

15

b7066b5ca5004b095502d71420c469e9ee925bfa

163769A1708F45F8ABE642374A97FA8A00293529

genes
[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
description
[Pubmed|17434969]
regulation
expressed during germination and spore outgrowth [Pubmed|24244006]
Open in new tab

[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]

2021-08-24 07:41:51

ghost

7

83f82fe93a5d7fc7c4cde98212b1c8cac4b0a273

3EB963FA933A46D0CD3DFCC171D4F5D901936AC9

Biological materials
Mutant
MGNA-B932 ([gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1931 NBRP B. subtilis, Japan]
GP2142 (''Δ''''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''tet''), available in [wiki|Jörg Stülke]'s lab
BKG2 (''[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::spc''), available  in [wiki|Jörg Stülke]'s lab
1A939 ( ''disA''::''tet''), [Pubmed|16713562], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A939&Search=1A939 BGSC]
GP2222 ([gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::ermC [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::''tet''), available in [wiki|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
BKE00880 ([gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA,  downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
BKK00880 ([gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA,  downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
GP2715 (''Δ''''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''spc''), available in [wiki|Jörg Stülke]'s lab
GP2752 (''Δ''''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''cat''), available in [wiki|Jörg Stülke]'s lab
GP2782 (''Δ''''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''kan''), available in [wiki|Jörg Stülke]'s lab
Expression vectors
IPTG inducible expression of His-''disA'' in ''E. coli'': pGP2563 (in [http://biochem.web.utah.edu/hill/links/pET19b.pdf pET19b]), available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Fabian Commichau]'s lab
References
Reviews
22933559,18714086,25869574,23812326,30224435,32472931,32603625
Original Publications
24244006,8793870,9987115,16713562,23760274,11544224,17434969,18439896,16713555,12493822,21566650,23192352,23608499,25616256,26014055,27150552,28420751,28511132,28961460,29536659,29588402,30877841,30916351,33510358,34073022

2B091CCEE9E34D659771E39B1FC9050A145048AB

Page visits: 5702

Time of last update: 2021-09-19 11:27:44

Author of last update: Jstuelk