SubtiWiki SubtiWiki
rhaM
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rhaM
168

mutarotase involved in rhamnose utilization

locus
BSU_31190
Molecular weight
12.44 kDa
pI
5.18
Protein length
Gene length
function
utilization of rhamnose
product
mutarotase
essential
no
synonyms
rhaM, yulD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3254

This gene is a member of the following regulons

Gene
Coordinates
3,199,233  3,199,547
The protein
Catalyzed reaction/ biological activity
α-L-rhamnose --> β-L-rhamnose (according to UniProt)
Protein family
rhamnose mutarotase family (single member, according to UniProt)
Structure
[PDB|1X8D] (from E. coli,  55% identity) [pubmed|15876375]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
description
[Pubmed|26712933,22383849]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]: repression, [Pubmed|26712933], in [regulon|protein:F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|26712933], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|26712933], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]→[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]

2021-07-19 15:18:16

ghost

5

19fb437091a8b0a4c85dca603a6b54dd43243683

2050B8CB3997650C17442F14F1C06F783D5E7647

genes
[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
description
[Pubmed|22383849]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
Open in new tab

[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]→[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]

2021-09-01 06:04:13

ghost

6

f78e9504a24134fdb2f0831248c760840f86c618

D3F58B4ED3CAB9282D2D0E5923C9CC3BE67E3819

Biological materials
Mutant
MGNA-A639 (yulD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/639 NBRP B. subtilis, Japan]
BKE31190 ([gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACCTTTTCACCTCTTCA,  downstream forward: _UP4_TGAAAAACTGATAAAGGGAG
BKK31190 ([gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACCTTTTCACCTCTTCA,  downstream forward: _UP4_TGAAAAACTGATAAAGGGAG
References
26712933,24391637,22383849,27766092,15876375

294C0CC675088B2A2EEFC26FAF1A628002B82C59

Page visits: 2025

Time of last update: 2021-09-15 09:57:02

Author of last update: Melvin.boenninger