SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


mutarotase involved in rhamnose utilization

Molecular weight
12.44 kDa
Protein length
Gene length
utilization of rhamnose
rhaM, yulD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3254

This gene is a member of the following regulons

3,199,233  3,199,547
The protein
Catalyzed reaction/ biological activity
α-L-rhamnose --> β-L-rhamnose (according to UniProt)
Protein family
rhamnose mutarotase family (single member, according to UniProt)
[PDB|1X8D] (from E. coli,  55% identity) [pubmed|15876375]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]: repression, [Pubmed|26712933], in [regulon|protein:F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|26712933], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|26712933], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2021-10-21 16:40:05





expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
Open in new tab


2021-10-26 02:00:36





Biological materials
MGNA-A639 (yulD::erm), available at the [ NBRP B. subtilis, Japan]
BKE31190 ([gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACCTTTTCACCTCTTCA,  downstream forward: _UP4_TGAAAAACTGATAAAGGGAG
BKK31190 ([gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACCTTTTCACCTCTTCA,  downstream forward: _UP4_TGAAAAACTGATAAAGGGAG


Page visits: 2066

Time of last update: 2021-12-04 09:08:22

Author of last update: Melvin.boenninger