SubtiWiki SubtiWiki
mneP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

mneP
168

primary manganese (II) efflux pump

locus
BSU_05470
Molecular weight
32.64 kDa
pI
6.16
Protein length
Gene length
function
Mn(II) export
product
manganese (II) efflux pump
essential
no
synonyms
mneP, ydfM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0053

This gene is a member of the following regulons

Gene
Coordinates
595,109  596,002
Phenotypes of a mutant
sensitive to Mn(II) [Pubmed|27748968]
a [gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP] [gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS] double mutant is extremely senitive to Mn2+ intoxication, this results in generation of reactive radicals by poisoned cytochrome aa3 oxidase [protein|48A9E1E39838BFFCF12CADF0A8D8E6FFDCA6F175|qoxA]-[protein|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]-[protein|CD4520EF427AEFDCF028AE063BC373FA6DCE379E|qoxC]-[protein|03335DC50CED7B38E2380640AE108ADA09A2CBDF|qoxD] and can be suppressed by inactivation of [protein|48A9E1E39838BFFCF12CADF0A8D8E6FFDCA6F175|qoxA]-[protein|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]-[protein|CD4520EF427AEFDCF028AE063BC373FA6DCE379E|qoxC]-[protein|03335DC50CED7B38E2380640AE108ADA09A2CBDF|qoxD] (any gene) or of [gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR] to activate the electrophile stress response [pubmed|34097790,31685536]
The protein
Catalyzed reaction/ biological activity
efflux of Mn(II) [Pubmed|27748968]
Protein family
[wiki|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] [Pubmed|27748968]
Structure
[PDB|5VRF] (Shewanella oneidensis zinc transporter, 26% identity) [pubmed|29507252]
Paralogous protein(s)
[protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS], [protein|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]
description
[pubmed|22383849]
regulation
expressed at elevated Mn(II) concentrations ([protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]) [Pubmed|27748968]
regulatory mechanism
[protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]: transcription activation, [Pubmed|27748968], in [regulon|protein:FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|27748968], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]

2021-10-18 20:00:31

Bzhu

6

89c2a3b34a7645bc19875381ace2811a10607e21

F21E57628E40256A004039FA9EF1045ABC349D88

Biological materials
Mutant
MGNA-C152 (ydfM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2150 NBRP B. subtilis, Japan]
BKE05470 ([gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCTATAAAA,  downstream forward: _UP4_TGAAAAGCTCCTTTTTAGAA
BKK05470 ([gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCTATAAAA,  downstream forward: _UP4_TGAAAAGCTCCTTTTTAGAA
References
27748968,29507252,31685536,34097790

28C7CFE5701F6920652BE1973DC7A15D7C088E35

Page visits: 1325

Time of last update: 2021-10-19 21:40:53

Author of last update: Jstuelk