SubtiWiki SubtiWiki
ydaP
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydaP
168

general stress protein, required for survival of ethanol stress, cold stress (4C) and oxidative stress (superoxide/paraquat), putative pyruvate oxidase

locus
BSU_04340
Molecular weight
62.97 kDa
pI
5.22
Protein length
Gene length
function
unknown
product
putative pyruvate oxidase
essential
no
synonyms
ydaP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0028

This gene is a member of the following regulons

Gene
Coordinates
488,830  490,554
Phenotypes of a mutant
sensitive to ethanol, cold (4C) and superoxide stress (paraquat)
The protein
Protein family
[wiki|TPP enzyme family] (according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|4KGD] (the enzyme from Lactobacillus plantarum, 37% identity, 70% similarity) [Pubmed|23748673]
[PDB|1POW] (from ''Lactobacillus Plantarum'', 38% identity)
Paralogous protein(s)
[protein|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS], [protein|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]
Expression and Regulation
Operons
genes
[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]
description
[Pubmed|10220166]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]

2021-06-23 02:23:25

ghost

2

38f54a0a4d2797eb662d510cfdb24f1195d7e121

809C1E798FDCB19B7C3EB708C80F3D7A131B5129

Biological materials
Mutant
MGNA-C115 (ydaP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2113 NBRP B. subtilis, Japan]
GP457 (spc), available in [wiki|Jörg Stülke]'s lab
JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
BKE04340 ([gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACGTATCCTCCTTTTT,  downstream forward: _UP4_TAAAAAAACAGGGGCCCTAA
BKK04340 ([gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACGTATCCTCCTTTTT,  downstream forward: _UP4_TAAAAAAACAGGGGCCCTAA
References
22582280,10220166,23748673,15805528,22730460,31534226

2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7

Page visits: 1716

Time of last update: 2021-09-18 21:03:13

Author of last update: Jstuelk