SubtiWiki SubtiWiki
ybfK

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ybfK
168

carboxylesterase NP

locus
BSU_02260
Molecular weight
32.92 kDa
pI
5.14
Protein length
Gene length
function
degradation of isoprenoid-containing lipids
product
carboxylesterase NP
essential
no
ec
3.1.1.1
synonyms
ybfK, cesB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0596

This gene is a member of the following regulons

Gene
Coordinates
246,658  247,548
The protein
Catalyzed reaction/ biological activity
carboxylic ester + H2O --> carboxylate + alcohol + H+ (according to UniProt)
Protein family
[wiki|AB hydrolase superfamily] (according to UniProt)
[wiki|Domains]
[wiki|AB hydrolase-1 domain] (aa 57-284) (according to InterPro)
Structure
[PDB|4CCY] [Pubmed|24418394]
Paralogous protein(s)
[protein|E5A59EE56092F8042128B19D5E8DEFAE41C78000|nap]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]-[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]-[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]-[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]
description
[Pubmed|22383849,14762009]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|14762009], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|14762009], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]→[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]

2021-10-15 02:38:27

Jstuelk

10

9c5c2fcf642de63f240b8ac199efc5b5939a836b

2A09CF2D25D4B824D045D3A292B8FC9B5A167361

Biological materials
Mutant
MGNA-B934 (ybfK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1933 NBRP B. subtilis, Japan]
BKE02260 ([gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCTTTTTCCTCC,  downstream forward: _UP4_TAGTAAGGAACATGAAAAGA
BKK02260 ([gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCTTTTTCCTCC,  downstream forward: _UP4_TAGTAAGGAACATGAAAAGA
References
11389736,24418394

27FB777AEBCC794A5A768C7FE7D8374BCEA75913

Page visits: 951

Time of last update: 2021-10-19 21:56:44

Author of last update: Melvin.boenninger