SubtiWiki SubtiWiki
yitI
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yitI
168

similar to glyphosate N-acetyltransferase

locus
BSU_11000
Molecular weight
17.47 kDa
pI
9.17
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
2.3.1.-
synonyms
yitI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2153

This gene is a member of the following regulons

Gene
Coordinates
1,178,218  1,178,682
The protein
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 2-146) (according to UniProt)
Structure
[PDB|2JDC] (from B. licheniformis, 59% identity) [pubmed|17272278]
Expression and Regulation
Operons
genes
[gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]-[gene|1A31885756344F8BD2BED4E4526D43D6D5AB85F3|yitH]
description
[pubmed|22383849]
Open in new tab

[gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]→[gene|1A31885756344F8BD2BED4E4526D43D6D5AB85F3|yitH]

2021-08-15 09:12:06

Jstuelk

1

bdb6372e020a317041d046c63380da4322654df7

AE0CE3517E22321963C7CDDEE702CD9992067DAA

Biological materials
Mutant
MGNA-B205 (yitI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1204 NBRP B. subtilis, Japan]
BKE11000 ([gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTTTTCTATATC,  downstream forward: _UP4_TGATCTTATGGACGTAGTAG
BKK11000 ([gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTTTTCTATATC,  downstream forward: _UP4_TGATCTTATGGACGTAGTAG
References
19258532,17272278, 15155947

2751630B6472346B19FB20F57F16013D0FACA9F7

Page visits: 1201

Time of last update: 2021-09-17 08:55:30

Author of last update: Melvin.boenninger