SubtiWiki SubtiWiki
sqhC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sqhC
168

squalene-hopene cyclase, biosynthesis of sporulenes, protection of the spore against oxidative stress

locus
BSU_19320
Molecular weight
71.05 kDa
pI
7.63
Protein length
Gene length
function
biosynthesis of sporulenes
product
squalene-hopene cyclase
essential
no
synonyms
sqhC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1657

This gene is a member of the following regulons

Gene
Coordinates
2,102,168  2,104,066
The protein
Catalyzed reaction/ biological activity
sporulenol --> H2O + tetraprenyl-β-curcumene (according to UniProt)
production of sporulenes, polycyclic terpenoid lipids [Pubmed|18436644]
protection of the spore against oxidative stress [Pubmed|18436644]
Protein family
terpene cyclase/mutase family (single member, according to UniProt)
Structure
[PDB|2SQC] (from Alicyclobacillus acidocaldarius, 32% identity) [pubmed|9931258]
[wiki|Localization]
surrounds the forespores [Pubmed|18436644]
Expression and Regulation
Operons
genes
[gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]-[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]
description
[Pubmed|18436644]
regulation
expressed during sporulation in the mother cell [Pubmed|18436644]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,18436644], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]→[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]

2021-08-16 03:38:16

ghost

2

6fa4c70048aebc58f3cffd6e248603b84d1b4262

DF3BA7099188F609C6B2A0A09963B06207F9360B

Biological materials
Mutant
BKE19320 ([gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTCAACTCCTTCA,  downstream forward: _UP4_GATTCTATTGAAAAGGAGAC
BKK19320 ([gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTCAACTCCTTCA,  downstream forward: _UP4_GATTCTATTGAAAAGGAGAC
References
18436644,9931258

24EB23F594F2B0EEA2E055857BA14FD9E361E0FD

Page visits: 1221

Time of last update: 2021-09-16 11:49:06

Author of last update: Melvin.boenninger