SubtiWiki SubtiWiki
ypiF
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypiF
168

unknown

locus
BSU_22570
Molecular weight
17.12 kDa
pI
5.09
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ypiF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,365,235  2,365,681
The protein
Modification
phosphorylated on Arg-4 (phosphorylation serves as tag for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]) [Pubmed|27749819]
Expression and Regulation
Operons
genes
[gene|230FA5701AE56753780E80E204C6A588ED7BC36B|ypiF]
description
[pubmed|22383849]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|230FA5701AE56753780E80E204C6A588ED7BC36B|ypiF]

2021-07-04 12:06:52

Bzhu

1

1b48bc290cf0eee60182997da6070e93b0d28c80

EF0B9AF01D667117D11C8809F2A0064DC19A9DD4

Biological materials
Mutant
MGNA-A505 (ypiF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/505 NBRP B. subtilis, Japan]
BKE22570 ([gene|230FA5701AE56753780E80E204C6A588ED7BC36B|ypiF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCTCCCCCTTTACG,  downstream forward: _UP4_TAAAAACACTTACATTTCCT
BKK22570 ([gene|230FA5701AE56753780E80E204C6A588ED7BC36B|ypiF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCTCCCCCTTTACG,  downstream forward: _UP4_TAAAAACACTTACATTTCCT
References
12850135,12850135,27749819

230FA5701AE56753780E80E204C6A588ED7BC36B

Page visits: 787

Time of last update: 2021-09-08 16:32:54

Author of last update: Jstuelk