alaP

alaP
168

alanine permease (L-Ala, D-Ala, ß-Ala)

locus
BSU_30530
Molecular weight
50.16 kDa
pI
9.91
Protein length
Gene length
function
uptake of D- and L-alanine and of ß-alanine
product
alanine permease
essential
no
synonyms
ytnA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1113 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,124,250  3,125,641
Phenotypes of a mutant
a [gene|219586A3F378DC38EA076FD39B99D41136BDE722|alaP] [gene|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|alr] double mutant is not viable due to the inability to acquire D-alanine [pubmed|33155333]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
uptake of D- and L-alanine and of ß-alanine [pubmed|38470260,33155333]
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|6F34] (from Geobacillus kaustophilus, 21% identity) [pubmed|29416041]
[AF|O34618]
Paralogous protein(s)
[protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|aimB], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|gabP]
[wiki|Localization]
Cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|52D4DA0AA45F0774543786B55D18DF9DF53A5029|metK]-[gene|6F5BBCBA02EA1C016AA37EB63D252A4C07CE6617|asnB]-[gene|219586A3F378DC38EA076FD39B99D41136BDE722|alaP]
description
[Pubmed|33155333]
regulation
constitutive
Open in new tab

[gene|52D4DA0AA45F0774543786B55D18DF9DF53A5029|metK]→[gene|219586A3F378DC38EA076FD39B99D41136BDE722|alaP]

2024-04-13 08:57:56

Jstuelk

79

EBD1A656EE2CBA59E12ED2624758B322F0A2AF06

074501579DF980959E9B85A1859566DB48AC89A9

Biological materials
Mutant
GP3580 (Δ[gene|219586A3F378DC38EA076FD39B99D41136BDE722|alaP]::''spec''), available in [wiki|Jörg Stülke]'s lab
GP4146 (Δ[gene|219586A3F378DC38EA076FD39B99D41136BDE722|alaP]::''neo''), available in [wiki|Jörg Stülke]'s lab [pubmed|38470260]
MGNA-A126 (ytnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/126 NBRP B. subtilis, Japan]
GP1885 (Δ[gene|219586A3F378DC38EA076FD39B99D41136BDE722|alaP]::''spc'') available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
BKE30530 ([gene|219586A3F378DC38EA076FD39B99D41136BDE722|alaP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE30530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCTTCTCCCCTAGA,  downstream forward: _UP4_TGACAAAAAGAGCTCCCAGT
BKK30530 ([gene|219586A3F378DC38EA076FD39B99D41136BDE722|alaP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK30530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCTTCTCCCCTAGA,  downstream forward: _UP4_TGACAAAAAGAGCTCCCAGT
lacZ fusion
pGP3820 (in [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab
References
10498721,29416041,33155333,38470260

219586A3F378DC38EA076FD39B99D41136BDE722

Page visits: 2975

Time of last update: 2024-04-17 08:30:55

Author of last update: Jstuelk