SubtiWiki SubtiWiki
yngE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yngE
168

methylcrotonoyl-CoA carboxylase, subunit

locus
BSU_18210
Molecular weight
66.13 kDa
pI
8.36
Protein length
Gene length
function
mother cell metabolism, leucine utilization
product
methylcrotonoyl-CoA carboxylase, subunit
essential
no
ec
6.4.1.4
synonyms
yngE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4799

This gene is a member of the following regulons

Gene
Coordinates
1,949,682  1,951,217
The protein
Catalyzed reaction/ biological activity
3-methylbut-2-enoyl-CoA + Biotin-CO2 -- 3-methyl-glutaconyl-CoA +  biotin [Pubmed|19935659]
Protein family
AccD/PCCB family (with [protein|E4997526CC534E38413030E90F7A135ECF65DF40|accD] and [protein|B6A05AD90A4AA553A8CCD8FFF504F5AD204ABAFB|yqjD], according to UniProt)
[wiki|Domains]
CoA carboxyltransferase N-terminal domain (aa 2-254) (according to UniProt)
CoA carboxyltransferase C-terminal domain (aa 260-506) (according to UniProt)
Structure
[PDB|1VRG] (from Thermotoga maritima, 40% identity)
Paralogous protein(s)
[protein|B6A05AD90A4AA553A8CCD8FFF504F5AD204ABAFB|yqjD]
Expression and Regulation
Operons
genes
[gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]-[gene|5F73ACDEAFC7F1EB26D55195100C3283FC1F587C|yngI]-[gene|CAF58B4BAEB03353CF80A2862590888D07B48E2C|yngH]-[gene|1FBF1512C28BCE04E7D51247D94DC88C72FBFF07|yngHB]-[gene|EEEE69A98DFAA3327FBC04F1422E959D8B44AF20|yngG]-[gene|D5CCFDE9312909B7E5B98876794569357791C76B|yngF]-[gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]
description
[Pubmed|12662922]
regulation
expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]→[gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]

2021-09-18 17:56:53

ghost

7

ec5ff58c486f073be542df6cbb7bc2ebb4e5deee

AC16F1F9497F11969688D82F5CC45D78083A44DD

Biological materials
Mutant
MGNA-B081 (yngE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1080 NBRP B. subtilis, Japan]
BKE18210 ([gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATAATCCATCAGCATTGCCT,  downstream forward: _UP4_TAAAAGCAAGAACTTAGGAG
BKK18210 ([gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATAATCCATCAGCATTGCCT,  downstream forward: _UP4_TAAAAGCAAGAACTTAGGAG
References
15699190,12662922,19935659

2192474E13EAF6D2CF97CB957864FC89ED0118E0

Page visits: 1185

Time of last update: 2021-08-11 12:25:30

Author of last update: Melvin.boenninger