SubtiWiki SubtiWiki
sdpA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

sdpA
168

required for [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin maturation

locus
BSU_33750
Molecular weight
18.51 kDa
pI
9.77
Protein length
Gene length
function
maturation of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin
product
unknown
essential
no
synonyms
sdpA, yvaW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,464,289  3,464,765
The protein
Paralogous protein(s)
[protein|FBA412B070CE4FFE554F2657E0F745EF5C853B8A|yitP]
[wiki|Localization]
cytoplasm [Pubmed|23687264]
Expression and Regulation
Operons
genes
[gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]-[gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]-[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]
description
[Pubmed|12817086]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|14651647,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|15687200,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]→[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]

2021-10-19 21:20:34

ghost

9

2fcaa28fd6df9e360eb7b7713a66bcca85a76c64

29EABA10B87FFC2DBA2CD17C1DA823E6512A5B7B

Biological materials
Mutant
MGNA-A453 (yvaW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/453 NBRP B. subtilis, Japan]
BKE33750 ([gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACAGTAATAATTCCCT,  downstream forward: _UP4_GTATGAAGATATTAAATAGT
BKK33750 ([gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACAGTAATAATTCCCT,  downstream forward: _UP4_GTATGAAGATATTAAATAGT
References
Reviews
20955377
Original Publications
12817086,14651647,15687200,15743949,15687200,17720793,12850135,23687264,21815947,34460312

219092C574A13B81CD312AEB55BAE48A3C541FB7

Page visits: 1701

Time of last update: 2021-10-18 16:43:38

Author of last update: Jstuelk