SubtiWiki SubtiWiki
kamA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

kamA
168

lysine 2,3-aminomutase

locus
BSU_19690
Molecular weight
53.91 kDa
pI
6.04
Protein length
Gene length
function
unknown
product
lysine 2,3-aminomutase
essential
no
ec
5.4.3.2
synonyms
kamA, yodO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1509

This gene is a member of the following regulons

Gene
Coordinates
2,139,454 → 2,140,869
The protein
Catalyzed reaction/ biological activity
L-lysine --> (3S)-3,6-diaminohexanoate (according to UniProt)
Protein family
[wiki|Radical SAM superfamily] (according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
PLP (according to UniProt)
Structure
[PDB|2A5H] (from ''clostridium subterminale Sb4'' , 60% identity)
Expression and Regulation
Operons
genes
[gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]-[gene|D8A050BF150C6E5B910C24C0E023F0829EC95BAD|yodS]-[gene|138832210AC94B17E081F3D0AF9BCFE3BE63E601|yodR]-[gene|161ADC907D4902001C8751F51CFA762828C26110|yodQ]-[gene|39749B5EADC3C056BAF232E0B586C65B989F7F77|yodP]-[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]-[gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]-[gene|0A33869E05CC9B49699555EA19D0905A55CA35B9|yozE]
description
[Pubmed|22383849,14523133]
regulation
expressed early during sporuation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|14523133]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|14523133], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]→[gene|0A33869E05CC9B49699555EA19D0905A55CA35B9|yozE]

2021-10-11 09:35:05

Jstuelk

6

44c21f8f9a51cb42563a9e5c6caad0babb60d90a

17328CC7373AFF7A88C018C39EBE54803F7E1157

Biological materials
Mutant
MGNA-B443 (yodO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1442 NBRP B. subtilis, Japan]
BKE19690 (Δ[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACGAACTCCTCCTCGCG,  downstream forward: _UP4_ACTGAATGCGGAGGGGATTC
BKK19690 (Δ[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACGAACTCCTCCTCGCG,  downstream forward: _UP4_ACTGAATGCGGAGGGGATTC
References
10839984,14523133

21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C

Page visits: 1303

Time of last update: 2021-10-11 09:36:44

Author of last update: Melvin.boenninger