SubtiWiki SubtiWiki
yuxN
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yuxN
168

transcription repressor ([wiki|TetR family])

locus
BSU_33030
Molecular weight
33.16 kDa
pI
7.66
Protein length
Gene length
function
control of [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] stability
product
transcription repressor
essential
no
synonyms
yuxN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
3,388,113  3,388,988
The protein
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 2-62) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]
description
[Pubmed|22383849]
Open in new tab

[gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]

2021-05-24 07:52:33

Jstuelk

2

284996c309403c14cb1a2268d33f3ab2326dfc0f

98C2B1B017C43EF73FAC790EDCCB0FC25223908D

Biological materials
Mutant
MGNA-B208 (yuxN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1207 NBRP B. subtilis, Japan]
BKE33030 ([gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTCCACCCTTTCGG,  downstream forward: _UP4_TAGAAGAACGGCTGCTTAAA
BKK33030 ([gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTCCACCCTTTCGG,  downstream forward: _UP4_TAGAAGAACGGCTGCTTAAA
References
20525796,30001325

1D6C340264B8A75727E202AD2E37053091C94013

Page visits: 1214

Time of last update: 2021-09-06 09:51:59

Author of last update: Melvin.boenninger