SubtiWiki SubtiWiki
mtlR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mtlR
168

transcriptional activator of the [gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]-[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD] operon

locus
BSU_04160
Molecular weight
78.67 kDa
pI
5.31
Protein length
Gene length
function
regulation of mannitol utilization
product
transcriptional activator, PRD-type
essential
no
synonyms
mtlR, ydaA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3711

This gene is a member of the following regulons

Gene
Coordinates
467,130  469,214
The protein
Catalyzed reaction/ biological activity
D-mannitol + Nπ-phospho-L-histidyl-[protein] --> D-mannitol 1-phosphate + L-histidyl-[protein] (according to UniProt)
Protein family
[wiki|PRD-containing transcription factors]
[wiki|Domains]
N-terminal DNA-binding domains, two [wiki|PTS]-regulation domains (PRD1 aa 195-300 and PRD2 aa 305-410), EIIB (Gat)-like domain, EIIA (Mtl)-like domain
[wiki|PTS EIIB domain] type-2 (aa 413-502) (according to UniProt)
[wiki|PTS EIIA domain] type-2 (aa 536-683) (according to UniProt)
Modification
phosphorylated on His-342 and/or His-399 by [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH] [Pubmed|20444094]
phosphorylation on His-599 by [protein|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA] [Pubmed|20444094]
phosphorylation on Cys-419 by [protein|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF] [Pubmed|20444094]
Effectors of protein activity
activity is stimulated by [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-dependent phosphorylation in PRD2 (mechnism of carbon catabolite repression) [Pubmed|20444094]
activity is inhibited by [protein|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-dependent phosphorylation in the EIIB(Gat)-like domain on Cys-419 (this prevents activity in the absence of mannitol and allows induction in presence of mannitol) [Pubmed|20444094]
[wiki|Localization]
upon interaction with non-phosphorylated [protein|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA], the active [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR] localizes to the membrane [Pubmed|23279188]
Expression and Regulation
Operons
genes
[gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]
description
[Pubmed|12897001]
regulation
repressed by glucose ([protein|search|CcpA]) [Pubmed|22900538]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|22900538], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22014119], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]

2020-11-06 12:56:32

ghost

0

94cbef71388f5fb1fe4cf9a5408dcb95147eee80

7B36DA36C65291ECB21349F02D2658BA28F7311D

Biological materials
Mutant
BKE04160 ([gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGACCTCCTAGC,  downstream forward: _UP4_TAAACCTGCATGGCACACGT
BKK04160 ([gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGACCTCCTAGC,  downstream forward: _UP4_TAAACCTGCATGGCACACGT
References
Reviews
23318733,9663674
Original Publications
12897001,20444094,10627040,10702268,9988713,23279188,22900538,22014119,26159071

1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2

Page visits: 1626

Time of last update: 2021-09-16 10:51:23

Author of last update: Melvin.boenninger