SubtiWiki SubtiWiki
yvbG

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yvbG
168

unknown

locus
BSU_33850
Molecular weight
22.44 kDa
pI
9.81
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yvbG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2095

This gene is a member of the following regulons

Gene
Coordinates
3,471,841  3,472,476
The protein
Protein family
UPF0056 (marC) family (single member, according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|1AA1FDF5EE7040A349522A927D8F6C1F691B3CF9|yvbG]
description
[pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|26577401], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|1AA1FDF5EE7040A349522A927D8F6C1F691B3CF9|yvbG]

2021-09-30 05:16:35

Bzhu

3

8ed718dc0645ca4eca01617c5834fff584c7dbab

439CE783D66DD01C964644A08B4B5E413AE6452D

Biological materials
Mutant
MGNA-A459 (yvbG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/459 NBRP B. subtilis, Japan]
BKE33850 ([gene|1AA1FDF5EE7040A349522A927D8F6C1F691B3CF9|yvbG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATACCTCCTTGTTGATA,  downstream forward: _UP4_TCATGATGCAAAAAGCAGCT
BKK33850 ([gene|1AA1FDF5EE7040A349522A927D8F6C1F691B3CF9|yvbG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATACCTCCTTGTTGATA,  downstream forward: _UP4_TCATGATGCAAAAAGCAGCT
References
26577401

1AA1FDF5EE7040A349522A927D8F6C1F691B3CF9

Page visits: 1076

Time of last update: 2021-10-10 07:12:22

Author of last update: Melvin.boenninger