SubtiWiki SubtiWiki
ysdA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ysdA
168

unknown

locus
BSU_28840
Molecular weight
10.18 kDa
pI
9.96
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ysdA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3326

This gene is a member of the following regulons

Gene
Coordinates
2,951,898  2,952,167
The protein
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]
description
[Pubmed|17289755]
regulation
[protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]: termination, via binding to a [wiki|RNA switch] in the [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC] leader region causes transcription termination, in [regulon|protein:803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT regulon]
additional information
autorepression of [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA] expression upon binding of excess [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT] to the untranslated region of the mRNA [Pubmed|29925569,17616982]
expression of [protein|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|IF3 ]is uncoupled from that of [protein|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|L35 ]and [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|L20 ]by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent mRNA processing [PubMed|21843271]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
Open in new tab

[gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]→[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]

2021-09-04 19:59:58

Jstuelk

7

6ec080dce630885303f3f439404a1624accce660

33D5901765B267FCB4C316CA6BBC47536C5ACFC6

Biological materials
Mutant
GP2391 ∆''[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]''::''kan'', available in [wiki|Jörg Stülke]'s lab
MGNA-B024 (ysdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1023 NBRP B. subtilis, Japan]
BKE28840 ([gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCCTCATCCTTTAT,  downstream forward: _UP4_GATTTATAAAAAGCAGAAAA
BKK28840 ([gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCCTCATCCTTTAT,  downstream forward: _UP4_GATTTATAAAAAGCAGAAAA
References
17289755,29925569

19349FDFE0F9A46FCCAA684B8139E592979DB317

Page visits: 978

Time of last update: 2021-09-06 21:03:54

Author of last update: Aklewing