SubtiWiki SubtiWiki
queC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

queC
168

synthesis of the modified ribonucleotide queuosine

locus
BSU_13720
Molecular weight
24.38 kDa
pI
5.15
Protein length
Gene length
function
tRNA modification
product
unknown
essential
no
synonyms
queC, ykvJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0603

This gene is a member of the following regulons

Gene
Coordinates
1,439,448  1,440,107
The protein
Catalyzed reaction/ biological activity
7-carboxy-7-deazaguanine + ATP + NH4+ --> 7-cyano-7-deazaguanine + ADP + H+ + H2O + phosphate (according to UniProt)
Protein family
queC family (single member, according to UniProt)
Structure
[PDB|3BL5] [Pubmed|18491386]
Expression and Regulation
Operons
genes
[gene|1925DFD1162E744E9175D07EC0FD72A75C79C6BF|queC]-[gene|BA6DD5C9AB9BFF9759E9ECC46CE3DF4EB7E67F52|queD]-[gene|F5189CAA5EF43FCF95E593E095F84B3BE486B347|queE]-[gene|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|queF]
description
[Pubmed|14660578]
regulation
repressed in the presence of queuosine ([wiki|preQ1 riboswitch]) [Pubmed|19285444]
regulatory mechanism
preQ1 riboswitch: antitermination, in the absence of queuosine [Pubmed|19285444], in [regulon|other_regulator:preQ1 riboswitch|preQ1 riboswitch]
Open in new tab

[gene|1925DFD1162E744E9175D07EC0FD72A75C79C6BF|queC]→[gene|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|queF]

2021-09-13 18:53:58

ghost

10

aa63ca74d3449d36e3337e94aa3ada3fd88e36c1

1D214C8F3DFBDBD36FAB40A469193DA1EEEACDF0

Biological materials
Mutant
MGNA-A789 (ykvJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/789 NBRP B. subtilis, Japan]
BKE13720 ([gene|1925DFD1162E744E9175D07EC0FD72A75C79C6BF|queC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTCCTCTCCTTCTCC,  downstream forward: _UP4_GAATATATGGTGATGAAAGG
BKK13720 ([gene|1925DFD1162E744E9175D07EC0FD72A75C79C6BF|queC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTCCTCTCCTTCTCC,  downstream forward: _UP4_GAATATATGGTGATGAAAGG
References
18491386,14660578,17384645,19285444,19354300,24003028,21410253,21375305,24663240,34013733

1925DFD1162E744E9175D07EC0FD72A75C79C6BF

Page visits: 2761

Time of last update: 2021-08-30 02:39:37

Author of last update: Jstuelk