SubtiWiki SubtiWiki
ypeP
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypeP
168

similar to RNase HI

locus
BSU_21970
Molecular weight
13.58 kDa
pI
5.24
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ypeP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0328

This gene is a member of the following regulons

Gene
Coordinates
2,308,967  2,309,647
The protein
[wiki|Domains]
RNase H domain (aa 71-207) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|1852AA40C48859202392834A3E791F6877DD3D30|ypeP]-[gene|A4B5C9A4BA04B0501766DADF19A49B67F92857C3|ypeQ]
description
[pubmed|22383849]
regulation
expressed during [wiki|sporulation] [Pubmed|22383849]
Open in new tab

[gene|1852AA40C48859202392834A3E791F6877DD3D30|ypeP]→[gene|A4B5C9A4BA04B0501766DADF19A49B67F92857C3|ypeQ]

2021-07-07 22:28:57

Jstuelk

2

0d3794ba835f3571d342cbb095f3093e852af7c2

5F0BD0C967B4353CB0432D9AFFFCA4DCBA7F2BB0

Biological materials
Mutant
MGNA-A893 (ypeP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/893 NBRP B. subtilis, Japan]
BP443 (''ypeP::tet'') available in [wiki|Fabian Commichau]'s lab
BKE21970 ([gene|1852AA40C48859202392834A3E791F6877DD3D30|ypeP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACAATCACCTTACCAT,  downstream forward: _UP4_TTAGACCGTAACGGAGATGA
BKK21970 ([gene|1852AA40C48859202392834A3E791F6877DD3D30|ypeP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACAATCACCTTACCAT,  downstream forward: _UP4_TTAGACCGTAACGGAGATGA
Expression vectors
for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [wiki|SPINE], based on [wiki|pGP380],  expression from plasmid: pBP501 (E. coli amp & B. subtilis E/L) , available in [wiki|Fabian Commichau]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Fabian Commichau]'s lab
References
Research papers
29084857

1852AA40C48859202392834A3E791F6877DD3D30

Page visits: 937

Time of last update: 2021-08-16 15:18:46

Author of last update: Melvin.boenninger