SubtiWiki SubtiWiki
murP
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

murP
168

N-acetyl muramic acid permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIBC of the [category|SW.1.2.2|PTS]

locus
BSU_01680
Molecular weight
47.44 kDa
pI
8.5
Protein length
Gene length
function
N-acetyl muramic acid uptake and phosphorylation
product
N-acetyl muramic acid [category|SW.1.2.2|PTS] permease, EIIBC component
essential
no
ec
2.7.1.69
synonyms
murP, ybbF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1264

This gene is a member of the following regulons

Gene
Coordinates
189,790  191,157
The protein
Catalyzed reaction/ biological activity
transport and concomitant phosphorylation of N-acetyl muramic acid
Protein family
[category|SW.1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIB domain] type-1 (aa 8-90) (according to UniProt)
[wiki|PTS EIIC domain] type-1 (aa 116-455) (according to UniProt)
Paralogous protein(s)
[protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP], [protein|531F132F7F6A878F1E1D56977B9898A14272349A|sacX], [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP], [protein|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]
Expression and Regulation
Operons
genes
[gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]-[gene|125872506C400CB6B3DAEA8B5130B064DFBA4494|murR]-[gene|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]-[gene|DEACFD435DB01C4B3ADEF397BEE08E2E7C7FCC36|amiE]-[gene|A5D4BF262BD365DCEBA9358C8DB295E605DE4D84|nagZ]-[gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|namZ]
description
[Pubmed|22383849]
regulation
expressed in late exponential and early stationary phase [Pubmed|20400549]
regulatory mechanism
[protein|125872506C400CB6B3DAEA8B5130B064DFBA4494|murR]: repression, [pubmed|30038046], in [regulon|protein:125872506C400CB6B3DAEA8B5130B064DFBA4494|murR regulon]
Open in new tab

[gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]→[gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|namZ]

2021-07-21 23:21:41

Jstuelk

6

63a61d46d8ccef554859655721937254bb90adc4

0CB715DED62C09573A88E4102ECFE473836124B4

Biological materials
Mutant
MGNA-B950 (ybbF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1949 NBRP B. subtilis, Japan]
BKE01680 ([gene|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACCCCTCCCCTTC,  downstream forward: _UP4_TAAATTGTTTCTGTTTTAGG
BKK01680 ([gene|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACCCCTCCCCTTC,  downstream forward: _UP4_TAAATTGTTTCTGTTTTAGG
References
10627040,15060041,22383849,30038046

178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2

Page visits: 2295

Time of last update: 2021-09-15 10:10:28

Author of last update: Melvin.boenninger