SubtiWiki SubtiWiki
kinE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

kinE
168

two-component sensor kinase, phosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F], part of the [wiki|phosphorelay]

locus
BSU_13530
Molecular weight
85.32 kDa
pI
5.49
Protein length
Gene length
function
initiation of [wiki|sporulation]
product
two-component sensor kinase
essential
no
synonyms
kinE, ykrQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5809

This gene is a member of the following regulons

Gene
Coordinates
1,419,213  1,421,429
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
two transmembrane segments
4 [wiki|PAS domain]s (aa 29-99, aa 150-220, aa 271-342, aa 391-462) (according to UniProt)
[wiki|Histidine kinase domain] (aa 523-729) (according to UniProt)
Structure
[PDB|3D36] (Geobacillus stearothermophilus [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB] in complex with the inhibitor [protein|CEFD10FAFA0DBC83CD2B61DAC9339FEE025B1611|sda], corresponds to aa 510 ... 727, 43% identity) [pubmed|19101565]
Modification
autophosphorylation on a His residue
Paralogous protein(s)
[protein|4EE48E4931F662E51586DB6D01E91C688329222D|cssS], [protein|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK], [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG], [protein|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|ykoH]
Expression and Regulation
Operons
genes
[gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]-[gene|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|ogt]
description
[Pubmed|2506524]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2506524], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]→[gene|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|ogt]

2021-08-21 22:30:43

ghost

2

63e752d8925a0480f853181e8e69a5b2e969362b

4B7DD3F359520D4DAAB003D0DC6AF3C2D719EB36

Biological materials
Mutant
MGNA-B319 (ykrQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1318 NBRP B. subtilis, Japan]
BKE13530 ([gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCATGTACACTCCTTCT,  downstream forward: _UP4_GAATGAACTACTATACGACA
BKK13530 ([gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCATGTACACTCCTTCT,  downstream forward: _UP4_GAATGAACTACTATACGACA
References
10094672,11069677,2506524,19101565

1582E81F7DA85F38D6732D341ABD0F052587F25A

Page visits: 1546

Time of last update: 2021-09-15 10:26:24

Author of last update: Jstuelk