SubtiWiki SubtiWiki
kinE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

kinE
168

two-component sensor kinase, phosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F], part of the [wiki|phosphorelay]

locus
BSU_13530
Molecular weight
85.32 kDa
pI
5.49
Protein length
Gene length
function
initiation of [wiki|sporulation]
product
two-component sensor kinase
essential
no
synonyms
kinE, ykrQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5809

This gene is a member of the following regulons

Gene
Coordinates
1,419,213  1,421,429
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
two transmembrane segments
4 [wiki|PAS domain]s (aa 29-99, aa 150-220, aa 271-342, aa 391-462) (according to UniProt)
[wiki|Histidine kinase domain] (aa 523-729) (according to UniProt)
Structure
[PDB|3D36] (Geobacillus stearothermophilus [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB] in complex with the inhibitor [protein|CEFD10FAFA0DBC83CD2B61DAC9339FEE025B1611|sda], corresponds to aa 510 ... 727, 43% identity) [pubmed|19101565]
Modification
autophosphorylation on a His residue
Paralogous protein(s)
[protein|4EE48E4931F662E51586DB6D01E91C688329222D|cssS], [protein|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK], [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG], [protein|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|ykoH]
Expression and Regulation
Operons
genes
[gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]-[gene|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|ogt]
description
[Pubmed|2506524]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2506524], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]→[gene|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|ogt]

2021-11-14 20:39:59

ghost

6

63e752d8925a0480f853181e8e69a5b2e969362b

4B7DD3F359520D4DAAB003D0DC6AF3C2D719EB36

Biological materials
Mutant
MGNA-B319 (ykrQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1318 NBRP B. subtilis, Japan]
BKE13530 ([gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCATGTACACTCCTTCT,  downstream forward: _UP4_GAATGAACTACTATACGACA
BKK13530 ([gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCATGTACACTCCTTCT,  downstream forward: _UP4_GAATGAACTACTATACGACA
References
10094672,11069677,2506524,19101565

1582E81F7DA85F38D6732D341ABD0F052587F25A

Page visits: 1618

Time of last update: 2021-12-02 09:11:13

Author of last update: Jstuelk