SubtiWiki SubtiWiki
yqfZ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yqfZ
168

unknown

locus
BSU_25060
Molecular weight
10.63 kDa
pI
8.09
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yqfZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,588,701  2,589,000
The protein
[wiki|Domains]
contains a N-acetylglucosamine-polymer-binding [wiki|LysM domain] [Pubmed|18430080]
[wiki|LysM domain] (aa 48-95) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|144A8B3F5E534F3FD6EFC1E9A5ED650E09DCE885|yqfZ]-[gene|4992F5C2ED7DE37C08D5715F7E8851F5FDB51059|ispG]
description
[Pubmed|12662922]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE], [wiki|SpoIIID]) [Pubmed|12662922,15383836]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|144A8B3F5E534F3FD6EFC1E9A5ED650E09DCE885|yqfZ]→[gene|4992F5C2ED7DE37C08D5715F7E8851F5FDB51059|ispG]

2021-08-22 21:54:14

ghost

5

7f29277c4da18ecbbf9247ac151795205592bbce

5FAA9F6ECFC53D5F888A9A3A86FCBB60ECB3EA36

Biological materials
Mutant
MGNA-C488 (yqfZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2486 NBRP B. subtilis, Japan]
BKE25060 ([gene|144A8B3F5E534F3FD6EFC1E9A5ED650E09DCE885|yqfZ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGCTTTTCCTCCCGCAT,  downstream forward: _UP4_TAATTTAACGTTAATTTCTT
BKK25060 ([gene|144A8B3F5E534F3FD6EFC1E9A5ED650E09DCE885|yqfZ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGCTTTTCCTCCCGCAT,  downstream forward: _UP4_TAATTTAACGTTAATTTCTT
References
Reviews
18430080
Original Publications
12662922,15383836

144A8B3F5E534F3FD6EFC1E9A5ED650E09DCE885

Page visits: 1238

Time of last update: 2021-08-31 23:07:50

Author of last update: Melvin.boenninger