SubtiWiki SubtiWiki
yodR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yodR
168

similar to butyrate-acetoacetate CoA-transferase

locus
BSU_19720
Molecular weight
23.19 kDa
pI
6.11
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
2.8.3.9
synonyms
yodR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2057

This gene is a member of the following regulons

Gene
Coordinates
2,143,022  2,143,675
The protein
Protein family
3-oxoacid CoA-transferase subunit B family (with [protein|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|scoB], according to UniProt)
Structure
[PDB|3CDK] (the [protein|A7E61C3D12BBDDD3EFD65B1EDBE280497D7B6CD0|scoA]-[protein|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|scoB] complex) (51% identity)
Paralogous protein(s)
[protein|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|scoB]
Expression and Regulation
Operons
genes
[gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]-[gene|D8A050BF150C6E5B910C24C0E023F0829EC95BAD|yodS]-[gene|138832210AC94B17E081F3D0AF9BCFE3BE63E601|yodR]-[gene|161ADC907D4902001C8751F51CFA762828C26110|yodQ]-[gene|39749B5EADC3C056BAF232E0B586C65B989F7F77|yodP]-[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]-[gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]-[gene|0A33869E05CC9B49699555EA19D0905A55CA35B9|yozE]
description
[Pubmed|22383849,14523133]
regulation
expressed early during sporuation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|14523133]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|14523133], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]→[gene|0A33869E05CC9B49699555EA19D0905A55CA35B9|yozE]

2021-09-13 01:12:06

Jstuelk

4

44c21f8f9a51cb42563a9e5c6caad0babb60d90a

17328CC7373AFF7A88C018C39EBE54803F7E1157

Biological materials
Mutant
MGNA-B506 (yodR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1505 NBRP B. subtilis, Japan]
BKE19720 ([gene|138832210AC94B17E081F3D0AF9BCFE3BE63E601|yodR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTGCAATCTGTTCTCTTT,  downstream forward: _UP4_ATGCCTTTTTCTTAAGAGGG
BKK19720 ([gene|138832210AC94B17E081F3D0AF9BCFE3BE63E601|yodR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTGCAATCTGTTCTCTTT,  downstream forward: _UP4_ATGCCTTTTTCTTAAGAGGG
References
14523133

138832210AC94B17E081F3D0AF9BCFE3BE63E601

Page visits: 1431

Time of last update: 2021-09-17 09:35:04

Author of last update: Melvin.boenninger