SubtiWiki SubtiWiki
citT

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

citT
168

two-component response regulator, regulation of citrate uptake

locus
BSU_07590
Molecular weight
25.26 kDa
pI
6.36
Protein length
Gene length
function
regulation of citrate uptake
product
two-component response regulator
essential
no
synonyms
citT, yflQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4565

This gene is a member of the following regulons

Gene
Coordinates
832,545  833,225
Phenotypes of a mutant
no growth with citrate as sole carbon source [Pubmed|10972810]
The protein
Catalyzed reaction/ biological activity
binding to the promoter of the ''[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]-[gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]'' operon and activation of transcription in the presence of citrate [Pubmed|10972810]
[wiki|Domains]
[wiki|Response regulatory domain] (aa 3-119) (according to UniProt)
Structure
[PDB|1YIO] (from Pseudomonas fluorescens, corresponds to aa 50 ... 207, 22% identity) [pubmed|16154086]
Modification
phosphorylated by [protein|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS] on an Asp residue
Effectors of protein activity
phosphorylation likely affects DNA-binding activity
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS]-[gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]-[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]
description
[Pubmed|10972810]
Open in new tab

[gene|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS]→[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]

2021-10-16 07:15:58

ghost

8

48338d903fc735b45d81f8161ce84e9f939ab895

A343A4499D2510EF9EAD9C7890ADE3F0FA94FC7F

Biological materials
Mutant
MGNA-C250 (citT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2248 NBRP B. subtilis, Japan]
BKE07590 ([gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCATCCTCCGCAATCGCG,  downstream forward: _UP4_TATTATTTGGCGGCGGATTA
BKK07590 ([gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCATCCTCCGCAATCGCG,  downstream forward: _UP4_TATTATTTGGCGGCGGATTA
References
Reviews
28152228
Original Publications
10094672,16842348,10972810,16154086

1345FBA88CB55E0E897FEC8DA4D829B85A8393BB

Page visits: 1530

Time of last update: 2021-11-12 02:18:01

Author of last update: Jstuelk