SubtiWiki SubtiWiki
citT
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

citT
168

two-component response regulator, regulation of citrate uptake

locus
BSU_07590
Molecular weight
25.26 kDa
pI
6.36
Protein length
Gene length
function
regulation of citrate uptake
product
two-component response regulator
essential
no
synonyms
citT, yflQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4565

This gene is a member of the following regulons

Gene
Coordinates
832,545  833,225
Phenotypes of a mutant
no growth with citrate as sole carbon source [Pubmed|10972810]
The protein
Catalyzed reaction/ biological activity
binding to the promoter of the ''[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]-[gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]'' operon and activation of transcription in the presence of citrate [Pubmed|10972810]
[wiki|Domains]
[wiki|Response regulatory domain] (aa 3-119) (according to UniProt)
Structure
[PDB|1YIO] (from Pseudomonas fluorescens, corresponds to aa 50 ... 207, 22% identity) [pubmed|16154086]
Modification
phosphorylated by [protein|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS] on an Asp residue
Effectors of protein activity
phosphorylation likely affects DNA-binding activity
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS]-[gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]-[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]
description
[Pubmed|10972810]
Open in new tab

[gene|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS]→[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]

2021-06-25 21:01:28

ghost

4

48338d903fc735b45d81f8161ce84e9f939ab895

A343A4499D2510EF9EAD9C7890ADE3F0FA94FC7F

Biological materials
Mutant
MGNA-C250 (citT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2248 NBRP B. subtilis, Japan]
BKE07590 ([gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCATCCTCCGCAATCGCG,  downstream forward: _UP4_TATTATTTGGCGGCGGATTA
BKK07590 ([gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCATCCTCCGCAATCGCG,  downstream forward: _UP4_TATTATTTGGCGGCGGATTA
References
Reviews
28152228
Original Publications
10094672,16842348,10972810,16154086

1345FBA88CB55E0E897FEC8DA4D829B85A8393BB

Page visits: 1508

Time of last update: 2021-09-15 07:33:44

Author of last update: Jstuelk