SubtiWiki SubtiWiki
metA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

metA
168

homoserine O-succinyltransferase

locus
BSU_21910
Molecular weight
25.85 kDa
pI
6.41
Protein length
Gene length
function
biosynthesis of methionine
product
homoserine O-succinyltransferase
essential
no
ec
2.3.1.46
synonyms
metA, metB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1897

This gene is a member of the following regulons

Gene
Coordinates
2,305,378  2,306,283
The protein
Catalyzed reaction/ biological activity
acetyl-CoA + L-homoserine --> CoA + O-acetyl-L-homoserine (according to UniProt)
Protein family
MetA family (single member, according to UniProt)
Structure
[PDB|2GHR] (from ''Bacillus cereus'', 60% identity, 77% similarity) [Pubmed|17546672]
Expression and Regulation
Operons
genes
[gene|1217330ECD588E24E42FF9FED2A097CEF32785F3|metA]-[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]
description
[Pubmed|22383849]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab

[gene|1217330ECD588E24E42FF9FED2A097CEF32785F3|metA]→[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]

2021-09-16 07:32:43

ghost

7

45e856ff37b7ee445afb9c87f96abb81194264ae

4B45D0C21B6BA8DCA11EA8FC7ACD2A28343A2152

Biological materials
Mutant
BKE21910 ([gene|1217330ECD588E24E42FF9FED2A097CEF32785F3|metA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGTGCCACCTCCATTAT,  downstream forward: _UP4_TAATTTTTCTTTTTTTAGTG
BKK21910 ([gene|1217330ECD588E24E42FF9FED2A097CEF32785F3|metA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGTGCCACCTCCATTAT,  downstream forward: _UP4_TAATTTTTCTTTTTTTAGTG
References
17546672,18179421,28581482

1217330ECD588E24E42FF9FED2A097CEF32785F3

Page visits: 1700

Time of last update: 2021-09-17 17:02:04

Author of last update: Melvin.boenninger