SubtiWiki SubtiWiki
argF
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

argF
168

ornithine carbamoyltransferase

locus
BSU_11250
Molecular weight
34.51 kDa
pI
4.97
Protein length
Gene length
function
biosynthesis of arginine
product
ornithine carbamoyltransferase
essential
no
ec
2.1.3.3
synonyms
argF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0078

This gene is a member of the following regulons

Gene
Coordinates
1,203,461  1,204,420
The protein
Catalyzed reaction/ biological activity
carbamoyl phosphate + L-ornithine --> H+ + L-citrulline + phosphate (according to UniProt)
Protein family
ATCase/OTCase family (with [protein|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB], according to UniProt)
Structure
[PDB|2EF0] (from ''Thermus thermophilus hb8'', 48% identity, 63% similarity)
Effectors of protein activity
inhibited at high ornithine concentrations, inhibition is enhanced by interaction with [protein|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF] in the presence of exogenous arginine (1 mM) [pubmed|4216455]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]-[gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]-[gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]-[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]-[gene|4202EAE5D0B2A718382092423DD99E35FDE81218|carA]-[gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]-[gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]
description
[Pubmed|7511775]
regulation
repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]) [Pubmed|1312212]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]: repression, [Pubmed|1312212], in [regulon|protein:62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|24843172], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]→[gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]

2021-09-12 16:24:51

Jstuelk

13

bd8576e7d6b5ef98ec61ff0587a9708cd8d39155

DA268D208C03E6C5DAF0361E4714668AC025F3EA

Biological materials
Mutant
1A605 ( ''argF''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A605&Search=1A605 BGSC]
1A606 ( ''argF''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A606&Search=1A606 BGSC]
BKE11250 ([gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTCCGTATAAACTGGTTT,  downstream forward: _UP4_TGAGCCAAACTCAGCAGTTT
BKK11250 ([gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTCCGTATAAACTGGTTT,  downstream forward: _UP4_TGAGCCAAACTCAGCAGTTT
References
6096675,24843172,12107147,1312212,7511775,4216455

11E7D77EF9439F817C10BF5D9671C5AE66AF06DC

Page visits: 1426

Time of last update: 2021-09-16 09:32:46

Author of last update: Jstuelk