argJ

argJ
168

N-acetylglutamate synthase

locus
BSU_11200
Molecular weight
43.20 kDa
pI
4.7
Protein length
Gene length
function
biosynthesis of arginine
product
N-acetylglutamate synthase
essential
no
ec
2.3.1.35
synonyms
argJ, argA, argE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1364 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,196,091  1,197,311
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
L-glutamate + N2-acetyl-L-ornithine --> L-ornithine + N-acetyl-L-glutamate (according to UniProt)
acetyl-CoA + L-glutamate --> CoA + H+ + N-acetyl-L-glutamate (according to UniProt)
Protein family
argJ family (single member, according to UniProt)
Structure
[PDB|1VZ6] (from ''Streptomyces clavuligerus'', 36% identity) [Pubmed|15352873]
[AF|P36843]
Modification
ArgJ has been shown to be synthesized as a precursor protein that undergoes proteolytic cleavage, leading to the formation of α and β subunits that assemble into heterodimeric or heterotetrameric molecules. [pubmed|11320085]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]-[gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]-[gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]-[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]-[gene|4202EAE5D0B2A718382092423DD99E35FDE81218|carA]-[gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]-[gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]
description
[Pubmed|7511775]
regulation
repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]) [Pubmed|1312212]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM] [pubmed|30355672]
regulatory mechanism
[protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]: repression, [Pubmed|1312212], in [regulon|protein:62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|24843172], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|rnpM regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]→[gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]

2024-04-06 15:00:42

Jstuelk

71

bd8576e7d6b5ef98ec61ff0587a9708cd8d39155

DA268D208C03E6C5DAF0361E4714668AC025F3EA

Biological materials
Mutant
BKE11200 ([gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTTCGATTCTCTCCCG,  downstream forward: _UP4_CGCACGTAATAAAGGGGAGC
BKK11200 ([gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTTCGATTCTCTCCCG,  downstream forward: _UP4_CGCACGTAATAAAGGGGAGC
GP3707 ([gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]::aphA3 trpC2) available in the [wiki|Stülke] lab
Expression vectors
pGP3774: expression of Strep-''argJ'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP3777: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
pGP3853: expression of ''argJ'' (''gapA'' RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
References
19649769,6096675,12107147,24843172,15352873,28516784,1312212,7511775

0FF858E44B3C557EE2C8B3749A458F152E1C535C

Page visits: 5065

Time of last update: 2024-04-17 07:28:15

Author of last update: Robert.warneke