SubtiWiki SubtiWiki
yfmK
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfmK
168

Nε-lysine acetyltransferase, acetylation of the histone-like protein [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|HBsu]

locus
BSU_07440
Molecular weight
17.17 kDa
pI
4.35
Protein length
Gene length
function
acetylation of the histone-like protein [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|HBsu], regulation of nucleoid compaction
product
Nε-lysine acetyltransferase
essential
no
synonyms
yfmK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1247

This gene is a member of the following regulons

Gene
Coordinates
817,311  817,757
The protein
Catalyzed reaction/ biological activity
acetylation of [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|HBsu] on Lys-80, probably also on Lys-3, Lys-18, and Lys-41 [pubmed|30808761]
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 8-148) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|0E6564B1B910694F28FD6EF5231E6F6A0E4BE545|yfmK]
description
[Pubmed|22383849]
Open in new tab

[gene|0E6564B1B910694F28FD6EF5231E6F6A0E4BE545|yfmK]

2020-11-06 12:56:32

Jstuelk

0

4d1b6d41b7a96004d138327c5ea9f003ec5a36cd

1AE4F519CF2F0F5DE959330CAB63ABC0B68ED385

Biological materials
Mutant
MGNA-C240 (yfmK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2238 NBRP B. subtilis, Japan]
BKE07440 ([gene|0E6564B1B910694F28FD6EF5231E6F6A0E4BE545|yfmK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCCACCTCCGCGCA,  downstream forward: _UP4_TGATCTCATCGAAACACAAA
BKK07440 ([gene|0E6564B1B910694F28FD6EF5231E6F6A0E4BE545|yfmK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCCACCTCCGCGCA,  downstream forward: _UP4_TGATCTCATCGAAACACAAA
References
Research papers
30808761

0E6564B1B910694F28FD6EF5231E6F6A0E4BE545

Page visits: 919

Time of last update: 2021-09-17 16:19:10

Author of last update: Melvin.boenninger