SubtiWiki SubtiWiki
azoR2

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

azoR2
168

similar to NAD(P)H dehydrogenase (quinone)

locus
BSU_33540
Molecular weight
23.13 kDa
pI
5.11
Protein length
Gene length
function
resistance to 2-methylhydroquinone
product
azoreductase
essential
no
synonyms
azoR2, yvaB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1182

This gene is a member of the following regulons

Gene
Coordinates
3,445,442  3,446,077
The protein
Catalyzed reaction/ biological activity
anthranilate + N,N-dimethyl-1,4-phenylenediamine + 2 NAD+ --> 2-(4-dimethylaminophenyl)diazenylbenzoate + 2 H+ + 2 NADH (according to UniProt)
Protein family
azoreductase type 1 family (with [protein|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1], according to UniProt)
Structure
[PDB|3P0R] (from B. anthracis, 43% identity, 61% similarity)
Paralogous protein(s)
[protein|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1]
Expression and Regulation
Operons
genes
[gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]
description
[Pubmed|17725564]
regulation
induced by catechol and 2-methylhydroquinone (2-MHQ) ([protein|search|MhqR]) [Pubmed|17725564]
regulatory mechanism
[protein|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]: repression, [Pubmed|17725564], in [regulon|protein:997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17725564], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]

2020-11-06 12:56:32

ghost

0

1a7a57d5b4b939a6aa2c8086b52e823c3b3bc93b

3EE588FB5273FB7C3410D218ACC658D1AFC37565

Biological materials
Mutant
MGNA-A444 (yvaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/444 NBRP B. subtilis, Japan]
BKE33540 ([gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTACCAGCCCTTTCG,  downstream forward: _UP4_TAATGAAAAAGCCTCCCCTT
BKK33540 ([gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTACCAGCCCTTTCG,  downstream forward: _UP4_TAATGAAAAAGCCTCCCCTT
References
17725564,18208493,16497325,12107147,27965289

0E2B1914A040666BAF042C0BE3F468144E1F1E06

Page visits: 1388

Time of last update: 2021-10-19 15:29:39

Author of last update: Melvin.boenninger